Description :
From Genome Similarity Track
Location :
contig_200:7014- 8305
Transcript NameFunction/comments
g12046.t1hypothetical protein

Sequence
1291 bases(100 bases per row)
GCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACACCTGGTAGCACTTAGTAGTCCTTCCCATGACCAAGTTCGAGATGAG
TGAAGACCAGCCCGCCGGACCTCCAGTGATGACCCTGGAGCACGCGGCCTCCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGCCTCGCGGCG
GTGTCCTGAGAAACCGTCGTCACCTCGCTGCTGAGCTCAGCGACCCCCGACCAACAGCGCCAAACCATCCAAGAGTTCATGGACCGCGAGCTCGCCGAAG
CAAAACGGCGAGTATCAACTCCCTCGCATGCGTCCAGGAACAATGCCGTCAAGATGGAGACATCCTCCTATTCTGGCGAGGGTCCTGATCGCCTACCTCT
GAATCGCTGGTTCAGAGAGATCGACATCGCGATCGCCTCGAGGCTAATCGAGGCGCCATCAGCCAAGGTGAACTTCCTGCTATCCCGTTTATCCGGAAAG
GCCAAGAATGGGCTCTCGGCAAACTTGTCGTCGACCAGTACGCGTTCCCGACTCTGAGGCACCAGAGCGACCTGCGTCTCGCCTTCGAACCACCGCAAGA
TGTGTCCGCGTTCGAGCTACATTCTTCGCCCTAAAGCAAGGCAAGATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCA
CGAAGCCGATCGACATGGCTTCCCAAGTCCATGTCTTTGTGTTTGGTATGTGAAGGTATGACGCGGTACTGTCTCACGCGCGCCGAGCCTGCCACGTTGG
AAGAAGCCTTCGCTCTCGCGCTACGCGAGGACTACCTGGTGACGTCGTCATACGCCAAGACGATGCCTGCGCAGACTCGGGTGTCGGTACCCGAGCCAAT
GGAGATCGATGCGATCGAGGCTTCGCAGAACGACGGTGGTCGTCCTCTGGGAGAGGCCGCGGTGGTCAGAATGACCTCTCGCTGAATTGTTTCCGCTGCG
GAAAGCCTGGTCATCGCGCGGCGGTGTGCCGCGCGCCAGCTCCGATCCTCGCCCACATGAAGCACGTCACGCCCGACGAGAGGATTCCGGCCGCACAGCC
AAAAAACGGCCGGGGCCAGTAGGTGCGGGGCGACCTACTGGCTGGAACGGAGGTCCGGGTCCCCCGGCGGCAGCCCGACCTCCTAGCCCCCTGTGCTCTA
TGCACACTTTAATGCCACCACTGCTAGTGGCGACTCGAGGCTGATTATTGTCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCG