Description :
From Genome Similarity Track
Location :
Scaffold_629:7014- 8119
Transcript NameFunction/comments
Phypl_g99192OG-Fe(II) oxygenase superfamily protein

Sequence
1105 bases(100 bases per row)
GctgtgtacatgtactgcatTCATATTCAACCAGTTGTGGTAGATCATTGTTCAATCTTTCCCTTTCTTCCGTGGTGGCTAAAGCAGCATCCGGTCTACG
AGTTCGCCACATCGATGGGGCCGTTGATCTTGAAGTCGCGGATCTGGTTCTCTTGGCCGAAGTCGGCGTAGTTCCCCTTGAATCTCGCCAAGCGGAACTG
GCGCCAGCTTATCGGGCGGTAGTTCGGCACGTCCCCGGGCTTCACCACGATGGGCTCTACATGCACGCTGTACGACGGACTGTAGAAGAACGGAGCCGAG
AGCCGTCCAGCCGTGTCGCTCGCCAGCACGCGATGCAACGGAGCAACGAACTGGTCGTTCGACCAGACCTGAACCATGTCGCCGATGTTGATCGTGTACG
TTCCCTTACGTGGTGGTACGTTCACCCACGTCTGTGACTCTCGATGAAGAACTTGCAGCGACgcgacctcgtcgtcctgcagcagaatTGTCAGCGCGCC
AGAGTCCGTGTGGTGGTAGACCCCCATGGTCTTCTCCGGGTCGGAAGCCACCGGGTAATGATTCAGCCTCATTGTGCTCGATGCGTTCGAGCGGAAGAAC
TGGTCGAAGAACGCAAAATCTTCACCCAATGCGACAGCAAACACCTTCAGCAGTCGGCGTGCGATGTACTCCATTTGATCGTAGTACGACCGCATTTTAC
TGCGAAATCCGGGCAACTTCGCCTCATCCAGCCACTGGTTTTCATCTTCTCCTAACCTTTCAAGCTTATCGGTGGCTGGGGCGTCTTCGCCGGCACCAGC
AAAGTCGAAACACTCCTTCCAGTCCGTCTTGTTCTTGGTGAGTTCGCCCTCGACGTAGCCTCGGTTGTTCGTGGCACTTCGTCCAATGGAGCGCTTCAAC
TCCTTTGGCAGACGGAAGAAGGAGCGCTGGGCGGCCTGGAACTCGCCCACTTCTTGTTCCGATAACCCATGATTCGCGATGTAGAAGAAGCCCCACTCAC
TGGCAGCGGCGCGAACCTCTTCGATGATCCTGTAAAGGCCCCCGTCCTTGGGGTCTCGTAGTGCGCCATCCACTGTCGCGTCGGTGGTGAACGCCATAAG
GGCGC