Description :
From Genome Similarity Track
Location :
Scaffold_37:70130- 74278
Transcript NameFunction/comments
Physo_135241reverse transcriptase

Sequence
4148 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTTGGCCAC
CGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGCCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGACCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCG
GCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCA
CTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATAAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCTCGTCCGCAGCC
CGGCTGTGGACGAACACATCGCCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAA
CCCATCGCGCAGATCAAGAGCACTGTATATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCA
TCGTTCAGCTTGTTATACGCATGAACGATGCGTCAGCCGCCCTGTGGTTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTT
GTCCAGCTTTGCGACGACTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGGTGACACAGTACTTCGTGCCCGGCACGA
AATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACT
CGTCTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCATCTTTGCACTGAGAGTGTCTTCACTCTCAGTGGTGGTCTCCATGAAGAACTGC
CTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGC
TCATGACTGGAAGCGAAGTCAACTCCGACGCTTCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTC
AACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGACCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGC
GCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCATGGACGGGTGTTCCTCTTCAATACCGCCGGCGGGTTC
ATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCATGACAGCATGCAAGTTTTTCCGGTGCGGAACGT
TTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTTCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTG
CGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGA
TCCAATGAGCTTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGTCTGTGTCATCCGTGCCCCTTGAGGTTGGAGACTCTTCCTGATTCGCTGAAAAG
CGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCTCGCGTGCGCCCAGGGCGCTCCTGG
ACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGAC
CGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGACCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAG
GACGATAAAGGTCTCGACAAACTCTTGATCTTCGTACGTGACGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACT
TCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCAC
GTAGAGAGCCACTTGCTCTCATCGAGTCCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGC
AGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCATCGTTTTTTGTTTGGTTGCGAC
GGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTACACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCACAACGGTAGCATCGCACATT
GTTTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTGGGC
ACATGTGCATGCAGCTTAGCCTACCGCAGGCTAGTCTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTATTCGGATACTCACGGAAGAGATAGG
TCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCT
CTGAGCGTAAACATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCCGAACTCGTTTTGCAGTGGCTCAAACGCTTGTCTGAGC
TCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTTCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGTGA
ACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTA
ATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAATCCC
AGAGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCTTCCCACA
CTGGGTCCGACAGGTGGGGACAGACAGCGCGTGCATCGTGAGTTACAGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGGTTCTCAGC
TCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGACCTACTTTGGCTCACTACTTTA
GCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCTTCGAGTATAGATTAATCTAAATAAACGAT
CCAGATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGC
TGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCCCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGG
TGGTCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGG