Description :
From Genome Similarity Track
Location :
Scaffold_94:7012- 11246
Sequence
4234 bases(100 bases per row)
GATCAAAAATATCGACGGCGTACGGACAATATTGCCAAAGGGGCACCTCGAATTCCCATGAGTTATCGGACTCAGGGTATTCAAGCCACCAACCAGATAC
TGGTATTGACCTCTGTGGCGATGCCACTTCAAAAGACTCTTCACATAGAACTGCAACTTCCCTTGCTCGTCGAGCAACACAGAAGAAGGAGGTCGGCATA
TCAGTGCAGGCTTGGGTGACTTGGTGTCCGAGGTGACGTGCCTCTGCGAGTCTCTCGATCACATGCGGAATGCACTTGATCAGTCGGAGACTGATTGGAA
ACAACTCCGGGAGATTCTCGATTAAGTGCAGCGCGCTCGTGAACAGTCATCGACTGAGTTGACTCAGTTGCGTGAGCAGATGAACCGTCTCGGCTTGGTC
GACACGATCGACAAACGAATGAGGAAGGTGGAGTACAAATTGCCTCGACTGGATAGCCAGGTGGATCTCTTAGCGACAATGGATTTATCGGGGTCGACTT
CCCTCCTTCAGGCACAAGCGCCATCCGAATCACGAGAGAAGGATCACGATATGGCATACGCAATGCAACGTAAAACAATGGGTGTATGCGCAGCTTAGCG
GAAGATTGGATGCGTAGGCAAGTCCCTTTTTAGCGATGACCTTGAACGGCAAAATGAAGTGCAGACGCAATTTTGACTTGAGACGGCAGACATTACATTT
ATAGGTAGTTTTTGAGCATTTAACAGGACTTGGTCTCCAACTTTATAAGAATCAATACATCCTCTGCCCTTAGCATCAGCTTGTTATTTTTGTTTATCTT
GGCTATCAGCCATTGCATCACGCACATTTGTAAGACACCAAAGCGCGTCGTGAGAAACTCGCTCATTTGTTTCTGCATAGTGTTAAAGCTGGTACCAGCA
GAGTTGTCAGCAAACGATCCCCCGCCAAGCCCGAAACCCGCAGTGGTATCGTGAGGCTATACATATTAAAGAGAGCAAAGCAGTTCGAGGTATGTACAGC
GTTGTTTAAAGCAAATTCGAAGACAGGGAGCATCATGCTCCAAGTCTTTGTCGACTCAGCACAAACACTGAGAAGCGCATCTCCAATGACGTGATTGACC
GCTCAGTTTGACCATCGGTCTGCGGATGATCTGATGTGGACATGTATAATCGTGTGCCAAGCACCTCGACGATGGAATTCTAAACTTTCCAGTCAATTGA
GAATTGCGATCAGAGATGATTGCCGAAAAACACGATCAATAAGGAGCAGAGCTGTACCTGTACCATCGAAGAAGTGCGGCACAGCCGCTAAGTGAGACAT
TTTGCTTAAACGTTCAACAAAGACCACAATCCGTGTATTGCGTTACAGTCTTTGGGAAATCCAAAGTACAAATTCCATGATGATGGGCTCCCGACACCCA
TTGGTCACCGGTAAACTAGCGAGCGGCGCAGACGAATGTGCCGAGAATTTGACCCGCTGGCACGTTTTACAGTTATACACGTATGTGCTCACCCATTTGT
AGAGCTTAGGCCACCAGCAGTGTTGACTCACAAATCCGTATATCTTTTCACGACCCATATGCCCACCGAGAGCAGTGCCATGGACCTTAAAGGGGATTTG
ATAATTCAAATTTTCATCGTGAGGTACAACAATGGGAGCGGTATCCGCTACATCGGTGCGATAGAACAAGAGACCATTATCTATGAAATATCGATGTAAG
CTGGCACGCAACTGTGCCGATAAATGAATGTCCGAGTCTTTGCACCCCTCAATCCCAAGGGCATAAAACAATGCCACCCATTGAGAATTCCGTCGATGTG
TCACACGAATTAACTAACTACTCAATAGGAGACGACAAGGTCGTGACATGATCAAGCTCATAGTCGGGACGACGAGATAGGGTATCTGCCAACACATTTT
GTTTGCCTGGATAATACTTCACCTCGAAGTTATATTCTGCAAAGAACAAAAGCCAACGAGCCCTTCTCTGATAGAGGTGAGGCGACTGTGTCGCCGTGCG
TAATGACGCATGATACGTGTATACGACGAATGGCTTGGAGCCGAGCAGATGAACTCTAAACTTGACGAGTGCATACTGCATAGCAAGTAGCACTTTACCA
TGAACTGGAAGTTCCTTATATCAGCTTTCAGCTGACGAGATTCTAATGCGATAACTCGCTCGTGGCCTGCAGAATCTGTTTGTAACAGGGCAATGTCTAT
GATAAAGTCGGATGCATCGTAGACAACACTTTGTGCAACGCCAAATTAAGAGCATGGAGAAGACTCTCCTTTATTGCTCGAAATGCGTCAGCATGGGTGT
TGTCCCAGCGAAAACCTATGTACTTCATAAGGAGATCAGTTAATGGCCGATCCATATCAGTGTAATTTTCACTGTATTTGTGTAAGCAATTGGCGAGGCC
AAGCAATTTACGCAAATCCTTTTAATTCTTAAGAATCGGCCAGTCCACTATAGCCTTGACCTTAGCGGGATCTGCTCGAAGGCCGCACATACCAATGATA
CATCCTAGATAAGGAATCTCGTCTGCACCAAAATTGCATTTAGACGCTTTGGCACACAATTCATTAGTGCTCATGCACTCGAGCACGGCTAGCAAATGAC
CGATGTCATTTTCAACATCTGACCGACCTTGTTCGGCACGACTATGGAAAAATGTCATCAAACTACGTCTGTGCGTAATCGCGATGGGACGAAAAAGTTG
CGTCACCAGACGATTAAATGTAGCCGTCACGTTAGATAGCCTTTATGGCATCACCAACCATTCCTATAGCATACCACTTGAAGTGCTCACTGCCGTCAGC
GAAAAAAATCACTCGCTCGCATGAGCAATTGGTAATATCCATAGACTAAGTCGATTGCACAATAGATAATACAATCAACTATGTTCTACTAAAGAACATC
CTTTCCAAGAATTGGTGTTTATGCCGGTATAGTGCTCGCATTAAGCTTGTTATAAGTATACACAATGTGCCAGTTGCCGTTAGCCTTTTTGACACAAATG
TCGGTGCCGAATATGGAGATTTATTCTCACGTACCATTCCTGCCTCATGTTGGCACGAAAGAAGTCACCAATGACGTCACGTTGTTCCTTTGGCAAGGGT
ACTGCGTTACACGACAGTGTAACGCAGTACTTGGTCCCAGGAACCAAGTCAATTTCATGACGGACACCTGTATCAGGAGGTAAAATAGACGGCGGGTCGT
GACACACAACATCTAGAAACGTCTTGACCAAAGGATAAAAGGGACCACGAGGATTTTTCAGTATCGATGATCCACTACGTGCAGTTAGTGCCGCTTTTGT
GTCTTCGAGAACGGCTTCTTCCAGAAGCGAAGAAGAGTTCAACTCAAAGATGTCGGCTCAAATAATTACCATTTCTAAAAACTAGTTATTCTATTGTGAG
TGAGTATTCTTATCGACTGACCATTCTTCTATTTCTAGAAAGGCGCCTAGCGAGGGTATAATTTCAAAGTTAGCCGTACCATCCCAGGTACCGGTCACTC
CGTTGAAGAGTGTTGACAGCTTGACGTCATTATCACGTCGTGACATAACAAACGCTTCGTGGCCCGACGTAGCCACTGGAGGTAAGTCTGAACGTCGCCA
AGATGTCATAGTAACAATCTTCCGGATTGGTATCATAATCAATCTGAATTTGCTCTGCACTAAATCTGATGTCACTACCGACATCCGATGACGAGTCATT
CGGCTCGATCTCGCTATCACGTGGATTACGTGCCTTTTTCACGCGCACCCGCTGAGCCGGGCTATGGATGCCTTAGTATTTCACCAACGACTTCAACATT
GACATTAGGCGCGTCTCTATCACAGCCGACGTCACTCAGTGGGTACAGACGTGTCACTCATGTTCATCTGATGGATCCAACCCTCGATAACTTAACTCTT
GGTCAGCAATTCTTTCAGCATTTAGTACTTTGTTCCCACTACGAATATAACTGAACTGAGTACGTGACGTTTCATTATCACATAACGAGCTTTGCTCAAT
ACTCGTGTCTTTGATATCGTCAGAATTAACATGTTCCGACATTCAGATGTCCAACACACTGACATTCTCAGCAATATTTTCGTGCCAATAGCGCTTCTGA
TTCCTAGCAGAGGTGGGTTCGTGACTCTCCAAATCTCCTCTAGGGGCAGTGCGCGTTGCGCCAAATGTTGTTGAACACCGATCAACCCATTGTTCGCGGT
GCTCAATCCAGATCATCCCAAGAATGAGATTATA