Description :
From Genome Similarity Track
Location :
Scaffold_19:70119- 71459
Sequence
1340 bases(100 bases per row)
TAGCTGTGGGGGGCTGACGGCAGATAATGACCGGCTAGATAGCAGATACTATAGCATCTACTACAAAAAAAGCTAAAGTTTTTCCTTTCTGGTGTTTTAT
GCACGTCGATCGACCAAAGATGGTCAATAATTGAGGCAGCTGTAAAATTAAAATACATATTTGATCCATCTATCTCCGCCACACTCTCCGCTTATCAAGT
CCTGATAGTGGCATTCAGCTTTAATTGAATAGACAGTAACAATATTGAGCAATCGTGACCAAGTGTAATTCACAGTTGTTCTTCTACTGTCTTCTACGGA
CCTGTGTTTGGTCTTTTTATTGTTGGAATTCCTTGACTGATGCTTTGTTTGCTATGTTAATTATCAGAACCTTCTACTGGATATAAGCTGCAGCGATGAG
CCTGCTATCTTATCGTTAGACCACTTCACTAGACCGACAGGGTAGGATGAGACTCAGATATAAACTCAGGTTATACAAGGGACATAATGAAGCTGAAGAA
GTGGATGTATACGCAGAGGAAAATGCGGATGATGTTTGAAACATGGCAGCGGATATTGGAAGGGGACGCAAATGGCGATGAGGTTTACAACAACAACAAC
GTCCAAGATTGCGCTGGCTTAAAGGAATATCAAACAAAACAAATTCAACGACGACCACGACCACAAATACATCGAATATGACGACGAACACGATGACGCC
GGCCAAATGGACCATTAAACGAAAATAAAAACAATGACTGCCACAAATACAACACCATGATCATGATTATTTCAACTTATTCTTTGTTCCGTTGCATTTG
TTATTATCTTTTCCTGATGTTAGTCGCAGCCGCAGCAGTTGCGAGAACGACAAAAGACGCATCACCGTCACACGGCGTGGGAAGCACATCAAAACTGGGC
GTAATACGTCGACCTACCTTTCCTCTTGCTTCGTTGTAGGATCTTCACAGTGCTCCCATTCGTGGGTTTTTTTCGTGCATGAAAATCTCCACCATCTTGT
TTAGCGGATCCCATCGATCGGTAGGACTACTCCAGCTGCATGTAGTCGGGTACTTCGAGTTTTCATCATCGGCTGTGAAGGTGCCGAGATCATGAGGTAC
CGATGGGACGTAACAATGAGGAAAACCAAGACTATGTCCATAGAATTGGACTGTACTGACACGTCCGCATCGGACCCTCAGCTGACGTCAATGGCTTCTT
CCGTTTGTTGTATGTCTCGTCCGTTCAATACGACAGCATACTGGTCTTTCGCTGCACGAAGAATTACCATTTCCATGTCTTGAACTTCTAACCGCACGTT
TTAGCCATCCTTGCATCATCACTCCCATCTCGTCGTCGCG