Description :
From Genome Similarity Track
Location :
Scaffold_448:7008- 8924
Transcript NameFunction/comments
Phypl_g8426hypothetical protein PHYSODRAFT_346079

Sequence
1916 bases(100 bases per row)
cggacggcgccgacgacatgtGCACGCTCAACCACCTGCACGAGCCggccgtgctcaagaacctggagctgcgcttcgccaagaagatgcccTACACGTA
CACGGGCGCCATCTGCATCGCCGTAAACCCGTACCAGTGGCTCGACCTGTACGGCAAGGAGCTGTACCTGCAGTACCTGGAGCAGCCGCGCGACTCGCTG
GCCCCGCACCCGTTCGCGCTGTCCGCGACCGCCTACATGGACATGAAGAGGACGCAGGTGGACCAGAGCATCCTCGTCAGTGGAGAGTCCGGAGCTGGCA
AGACCGAGACGGTCAAGATCATGATGAACCACTTGGCCTCCATCTCCGGCGGGGGCAATCACGGCACCAAGGTCATCGACCAGGTGCTCAAGTCCAAccc
gctgctcgagagcttcggtaacgccaagaccaagagGAACGACAACTCGAGTCGGTTCGGCAagttcgcgcagctccagttcGACAGCATGGGCTCGCTC
GTGGGGTGTCTCTGCGAGACgtacctgctggagaagagcCGCGTAGTGGGGCAGACCGAGGGCGAACGCAACTACCACATCTTCTACCAGATCTTCTGCC
TGCCCGAGGACCGCAAGacggagctcaagctgaGCGGAGACGTCACGAGCTACAAGTACGTGACGGAAGGTGCGGACGCCGAGCTCACCGGCATCGATGA
CGTCCAGTGCCTGAAGGAGAcgcaggacgcgctggacaCGATTGGGATCACGCCGGAGGAGCAGAGTGCCATCTTCGAGATTGTCGCGGCCATCCTGAAC
CTCGGCGAGACGGAGTTCGAGCAgaacagcaacgacagcgagaagTGCCACGTCAGCAACGAGGACGTTGTGGACAACGTCGGAGCTCTGCTGCGTACCG
AGAGCGCTGCCCTgcactcgacgctgctggagcgttCCATCACGGCCGGTTCCGAGTCGTACACGATCCCGCTAAACGCCGAGCAGGCCACAGACCTGCG
CGACGCTCTGGCCAAGGGCATGTAcacgcagctcttcgactGGCTCGTGCACCGTATCAACAAGGCTatctgctccacgaacaACGTCAACACGCACATT
GGTCTGCTGGATATCTTCggcttcgagagcttcgaCCAGAACGGCTTCGAGCAGCTGTGCATTAACTACgcgaacgagaagctgcagcagaagttcAACA
GCGACGTCTTCAaggacgtgcagcaggagtATGTGGATGAAGGCATCCCGCTGACGCTCGTGACGTTCGAGGACAACCAGCCCATTCTGGACCTGATTGA
GGGCCGCATGGGTATCGTCAGCATGCTGAACGAGGAAGTACTCCGCCCCCAGGCCACGGACAGCACGTTCGTGAGCAAGGTTCTGGACGCGTGCAGCGAC
CACCCTAGCATCGAGAAGAACAGAATCAACCCATTGGAGTTCACCATCCACCATTACGCTGGTGACGTGACGTACAACGGCACGGGCTtcctcgagaaga
acaaggacaCGCTGCCTACGGACATGGTACAGCTGCTGTCCGGTAGCTCGAATGACGTTATCTCGGGCATCTTCACGCCCACGCAGAAGGGGGGAAAGCG
TAACAGCCGCGGCAAGCACGGAAAGGAAGGCCGCCAAAAGGGTTTCCTTGTTGGTAACACCATTGCGGGCGCCTTCCGCAAGCAACTGACGGAGCTTATG
GAGACCATCAGCAAGACGTCATCGCAGTACGTGCGTTGCATCAAGCCGAACGCTAACAAGAGTGCCGTGGAGTTCAACCGCGTCATGATTgtggagcagc
ttcgttgcGCCGGTGTGATTGCGGCTATCCGCATCAGTCGTGCAGCCTTCCCTAACCGTCTGCcgctcgtcgagttccagcagcgtttCCAGATTATATG
CCCGTCGGCACTGCGC