Description :
From Genome Similarity Track
Location :
contig_2:700573- 701997
Transcript NameFunction/comments
g666.t1XP_002999165.1 nucleolar protein Nop56 [Phytophthora infestans T30-4

Sequence
1424 bases(100 bases per row)
TGTGCTTTTTAGACTTCTTGGACTTTTTCGTGGGGGCCTCCTCCTCGACCTCCTCCATCTTGACGTCCTCGTCCGCAGCAGGGCGCTTCTTGCCCTTCTT
CTCCTTCTTAGACTTTTTGTCAGTCTGAGTAGCCTCCTTCTTAAGCTCCTCCGAGACCTCCAACATCACGTCAGCGTTCTTACGCGGGGCAGCGCCGCTC
TCATAGAAAGCGAGACGCTCCTCAACCTGCTCACGCATCTTGTCGCCGTACTTGGTGGTGGGCTCGTCAATGAAAGAGTCAATGCGCGAGGCAATGGCGC
ACTTGTTGGCTAGGTAACGCGAGATGCGTCCCTTGTTCTTGGCAGCGGCGCGGCCAATGAAGGTAGAGTGGAAGAGCAGACCGTACTTGGGGGTGTTGCC
GCGGGTCTTGAGAGCACGGAACAGAGCCTTCTCGGCACCAAGAATCTGCACCGTCGAGGCCGGGCACTTGGCCAGGTTGGTCAGCGAACCAGCGTGCGAG
ATAAGGCGGGCACCCACCGACTCGCCGATAAGCGAGGCAAGGTTGGGGGCCACCGTCGACATCTTGGACACCAGGTACTCGTGCAGCTGGCGACGGTACT
CGGCAAGCTTAACAAGACGCGTGGTGAAGTTGTCCACGTTGATCATGTCGATCTCCGACATGTCCATACCCATGGAGGAACGCGAGGCGTGCAGGATCTG
CTGGGCCTTGTCCTCGTCGAGGACGATCTTCGACAGCTCCTCGAGCGAGTCCTCGCTCAGCGTGTTGCGGTTCTTGATGAACGACGCGCAACGGGCGTAC
ACGTAGTTGTCATTGACGATCTTTACCAGCTCGGGGAAGTGCCACGAGTACCACTCACGTACGCGCATGGCGAACGTGTTGATGTCCTTGTCCATCTGGT
CCAGCAGCGCAATCGCCTGGATGATCATGTTGTCGGCACGGTTCACGTTGAATTTGACCTTGGCACGCGAGTACGAGTGGCCGAGACCGAGCTGGGCCTT
GGCGAGGTTGCCCTGGGCCAGCTCCTTGACAAACGTGCTGAAGTGCATGCGCACGCCGCGCACGATCTCGAGCGTCGTCTCACTCGTGTTGCAGGGTGCG
CTGAGCTCGTCCGAGATGGCCTGGGCGAGACCCTTGTCCTGCACGCCGAGAGCGAACTTGCCCTTCTTGCCGGCCTTGACCTTGGGCAGGTTCATCTCCA
GGAAGTTCTTGAGGTCCTCGCTCAGCAGACCTTCCGAGATGTTGTTGATGTTCTCGAGGGCGTTCTCGGCCGATGTGAACGGCTGGAAAGCCTTGAGCTT
CACGACGCGTCCGAAGGAGGACATCGGCGACGGCGGCCTGCACCTCGCTCAGGAGGGAGCCGATCTCCTCGTTCTCCACCACCTCAAAGATTGCATAGCC
CGAGGCCGACTCGAATAGCACGAA