Description :
From Genome Similarity Track
Location :
contig_2:700552- 701976
Transcript NameFunction/comments
g730.t1hypothetical protein

Sequence
1424 bases(100 bases per row)
TGTGCTTTTTAGACTTCTTGGACTTTTTCGTGGGGGCCTCCTCCTCGACCTCCTCCATCTTGACGTCCTCGTCCGCAGCAGGGCGCTTCTTGCCCTTCTT
CTCCTTCTTAGACTTTTTGTCAGTCTGAGTAGCCTCCTTCTTAAGCTCCTCCGAGACCTCCAACATCACGTCAGCGTTCTTACGCGGGGCAGCGCCGCTC
TCATAGAAAGCGAGACGCTCCTCAACCTGCTCACGCATCTTGTCGCCGTACTTGGTGGTGGGCTCGTCAATGAAAGAGTCAATGCGCGAGGCAATGGCGC
ACTTGTTGGCTAGGTAACGCGAGATGCGTCCCTTGTTCTTGGCAGCGGCGCGGCCAATGAAGGTAGAGTGGAAGAGCAGACCGTACTTGGGGGTGTTGCC
GCGGGTCTTGAGAGCACGGAACAGAGCCTTCTCGGCACCAAGAATCTGCACCGTCGAGGCCGGGCACTTGGCCAGGTTGGTCAGCGAACCAGCGTGCGAG
ATAAGGCGGGCACCCACCGACTCGCCGATAAGCGAGGCAAGGTTGGGGGCCACCGTCGACATCTTGGACACCAGGTACTCGTGCAGCTGGCGACGGTACT
CGGCAAGCTTAACAAGACGCGTGGTGAAGTTGTCCACGTTGATCATGTCGATCTCCGACATGTCCATACCCATGGAGGAACGCGAGGCGTGCAGGATCTG
CTGGGCCTTGTCCTCGTCGAGGACGATCTTCGACAGCTCCTCGAGCGAGTCCTCGCTCAGCGTGTTGCGGTTCTTGATGAACGACGCGCAACGGGCGTAC
ACGTAGTTGTCATTGACGATCTTTACCAGCTCGGGGAAGTGCCACGAGTACCACTCACGTACGCGCATGGCGAACGTGTTGATGTCCTTGTCCATCTGGT
CCAGCAGCGCAATCGCCTGGATGATCATGTTGTCGGCACGGTTCACGTTGAATTTGACCTTGGCACGCGAGTACGAGTGGCCGAGACCGAGCTGGGCCTT
GGCGAGGTTGCCCTGGGCCAGCTCCTTGACAAACGTGCTGAAGTGCATGCGCACGCCGCGCACGATCTCGAGCGTCGTCTCACTCGTGTTGCAGGGTGCG
CTGAGCTCGTCCGAGATGGCCTGGGCGAGACCCTTGTCCTGCACGCCGAGAGCGAACTTGCCCTTCTTGCCGGCCTTGACCTTGGGCAGGTTCATCTCCA
GGAAGTTCTTGAGGTCCTCGCTCAGCAGACCTTCCGAGATGTTGTTGATGTTCTCGAGGGCGTTCTCGGCCGATGTGAACGGCTGGAAAGCCTTGAGCTT
CACGACGCGTCCGAAGGAGGACATCGGCGACGGCGGCCTGCACCTCGCTCAGGAGGGAGCCGATCTCCTCGTTCTCCACCACCTCAAAGATTGCATAGCC
CGAGGCCGACTCGAATAGCACGAA