Description :
From Genome Similarity Track
Location :
Scaffold_612:7005- 9097
Transcript NameFunction/comments
Phypl_g9792hypothetical protein

Sequence
2092 bases(100 bases per row)
TCTTAATTGGGACGGTATATCCGCACAATAATGTAGTCAATACCAATAGCCCGGTAGGTTTTCGCTTTTATCCATCGCTCCTTGTCAAGCGAGAATGCAC
CCGACTTGCTCACGTGGACGTCCTGCAGCCTGGTGGGTGACGAGAGTGATGGCGTCGTTGCAGTTCCTGTTGCTCCGGTAGGCGTTGTAAACCCGGATGC
GATGGCTCAGGGGTCGTGACTCCAGCAACCGAacctcggccaccacgaccagAGCCGAGTGCCTGACCGACAGCGCCATCTACACCTCCGTCAACCTTGT
CACCACCATCACTGCCACGTGTTTCAACTCCTGCCCCAATAACAAACACACGGTTAGCTTCACCACTCGCTCTTGAAGCCCAAGTCGCGAGACGCACCCA
TAGTACTTGAGGTTCATGCCGCCGAGGCCTAGGTTTTCCCCGCCCctcacgcgcagcacgcccTCGCACACTACATCCAGCGACGTCAGCTTGGCTGGCC
GTGTCATCGAATCTCTCCCCGGCTTCCCCACCAGCCCCACTGCTGCGTACAACTGCACCTACCAAATCAACAATCGCGAAGTTAGAAACTACATCACCGT
TGGTAGCAAAACCTgcaagcagcacctgctgcgctgATAGCACTTCCAACTCGACGGGCTGCACGCCCTCCGCGTCCACCATCCGCACCTCACGCTCTGC
GCTCggcagcgactgcgtggAAGGTTGTGCCCTAGTTGTAGTCGGCAGCTCCTACATCACAAACGAAGCTCACGATTAGTTAGTACATCAGGCACAGCAT
TGCCACAGGCTGCGTCACAAAGCAAGCCATACCTCCTGCTTTTGGTGGGTTTGTAGCTCcctggtcgtcgtggccttGCCTGGTACCTTGCCATGCGCCA
CCGACGTCGCAATTGTATGTGCCATCACTAACACCAACGCCACCAACAAGCACAGCGTTAGCCACACTACTAGCACTATCAGCCTCACGACATTTACAAC
AGCTGGTGCCTTGCCTACGCCTTaatctgcttcttctgctgcaacaTCGCGGACGCGCATGTCCTCAATGTACCTTATGACGGTCAGTTCACCGAGTAGG
TAGTCAGATCTGCCTTCTTCCAGGTCGAATGTATTTGTAGTGCGAGTCTAAACACTTGCTGGAAGGCCGCTTGGACGTCCAGCCAGCTTTCGCCAAAAAA
ACCCACACGTTCTTGAACACCGCGACGCATCAGAGACTGCTGGCTGTCACTGCCCCCTTGACGCCGGATCGCAGGCGGGGCTTTCTGGTGCTGCCCGGCT
CGTCATGCTTGCGCTTCTGTCCGGATAGCGCTTCCGCTATTACTGGCCTGATTTATTATGAGAGCGGGGATCGGTGGAAGGCTGATACGCGTCGTCTATT
CGTGGAAAATATAAACGTTCATAAATACAGATATTGTATCATTCGTCATGTTTGATACACATTCAAACATAGGATATATAAATTCGTAGAGTATCCACAA
CATCTTGAGAGCCAAGATTTGGCGGCAAAGCGTCGCATACACAGATCATCTTATCCAATACACAGTGAAAGATATATGCGCCAGCGCACAACGTTGTTCA
TATCACCTTTACGGAGCCATACGGATACAAAGATATATAATGGCGTGAAACCCGAGCGCGGAAGCTGCGTGAAATCGAGCGCGAAAGCTTGGGCCGCAAG
CATCGCGAGCATCGTCTTCTGGCCAACGCTGGCGCGTCACCATCCCGAAAATGGTCGGTGAGGCGACTAGCTTTGTAGGATTCGCCGTTATATTTCCGCA
GTGGAACGCTGTACCATTTCGTTTTGATCAATCACAATAGTAGAGGCCTCAATCAGCCTCGACCACTCCAAACATTCGCTTATTATCGAATGAAAACGCA
AcctaaaagggcgcaaaCGCCATTTCAGGTCGGAAGTCATCATTGCCAGCTGCAACGTGTTTGATTTGTTCAACCCCCTGTGTCTATCAACAACTAAAAG
GCCGTTTTCTGCGTTCGTTTACACTGATTTGGCTTCAGTTTGCATAATATAATATCGAAGAACATATAACTGCTCttcgcgaaagggttagA