Description :
From Genome Similarity Track
Location :
Scaffold_263:70045- 74620
Sequence
4575 bases(100 bases per row)
CGACCTGGAAGACTCGCTCGCGCCGGTGGCACCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAAGCTTTCCCGTAAT
TACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGA
AGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAGGCAGAGTACACAGGGATGATTTACGGTGTCAAGGCTGCTATTGCGCACGG
TGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCACTTGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAAT
ACTCACAAGGAACTCACGCCAAGCTTCGATCAGTTAAATAGCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGA
ATCGAAGGTCAGTCGGGTAATCTTGGCTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGCCCTCACTATGGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAA
AGCATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCGAACCCTCCAGAAGCTTCGGAAGAGATGGA
AGATCCTGCAAGAGCTCCACCGAGATCTCGTTTTGGGATTGGGAGCCGGGCGTGGTTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCT
CACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGAACGAGCTGGAACTGCCTGATCGAAGTGGGTATCGCTTTTACCCAGTAG
TGCATGTGTCGAGACTCAAGGCTGTCAACGAATTCAACAGTCGACCGAACACTCGGTTGGTACTAGACACGACTAATGAAGCAAGACTCGATTTCGATGA
GGAACTACTGCCTGAGGACAGCTGGGAACCAGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACAGAACACCACTAACGACGAGCACG
GAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGAACCATCATCAAACTTGTCATGTGGAGGTCTGCTGTACGACT
ATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTTGATCACGTATGAACTGTCCACAGGGCGATG
CAGCCTGTGGTAACAGACGAAGAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACAACATGAACATGATTACGCTGTGGAAGTGGATTAAGA
ATAAGAAAACATGAATGCCGACCGCGGAGCGATCACTGAAAACGAAGTCACGCGGGACACCTCAACAGTTAGCTGAGATGCTGGAGAACGTCGTAGAACG
TGCAGCGAGGATTCAAATCGATTCCAAGTGTCTGGCCGCGGTGGCCAAGAGTGTCAACGAAGCCGAGTCACCACTCTCCTTCTCCTCTTCATCAAGAACC
TGAGCCTCGGCAGCTGGAGCTGAAGCCGGACCCTGCGAATCCTCGGTACCAGCTTCAACAGGAGCAGCAGCCAGAGCAGGACGTGGAGTACCCGGTGGCG
AGTCAAACAACGAGCGCCAGGTCGGAATAAGCTCGGTTGAATCGAGAGACGGGTCAACGATCACGCTTCGGTACACATCCACGAAACGCGTACCACGAGG
ATTGAAGAACTCCGGGTTACGCTGGCACGGGAAGTACGTGGTGTTGTACGGGTGCTGATGCGGCGCATTCATCCATCCAGTACGCCATGGCTGACGAGCG
TCGAGAGCCGGAACCTCGGAAAGCCAGTCAGATGTCTGAGGTGCGAATGGCAAGTTTTCAATGGGGTACCACGGCTTAGACGGCTCCAAAAGCAACTCGG
GGCGAATGAATGACACGCCGGAAGCACTAGATGAAACCGAGTCACGACTCCACGCCATGTACTGCTCACGGTACTTGTTACGAAGACGATCGGCACGACA
GTCGCGCTTACTGAAGAGCTTCTTTAACATAGCTCTCAGTTCCTTCAAGCGTTCATTGTCGTGGCCAACCTTTTTAGCTTCTTCAGCGAGACCTTTGTTC
AATACCAGCTAACGGAAGCCAGTGGAGACGCTCCCACAACGCGAACCCGAGGTCACCTTGCTTACCGCCGTCACCCCGAAGGTTCGCCCAGATCATCTTG
AGACGGGTCTCAATCGGAGCACGCTTGGAGATGGGGACGCTTGGTTTGAAGTCGACAGTGTCAAAGAGGCAAGCTTGAAGAGGATAAAGCTGCCGAAGTT
GCTGGTACGGGTGATCAGGATGCGAATAATCAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGCTAA
GCTCAAGAGTCGCTCGAAACACTTCTTGGCGCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACC
ATAGGGCGAATACCAGATAACACTCGGTGAGGCAACGGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAAGTGTAGGTTGCCGTAATCATGCGTC
CAGGTCCAGCATCGAGAGTCCAAATAGGCGGACGAGGAGACCCTGGAACAGGAAGAGAAGATGCTGGTGCCGGAGGACTTGCTGGTGGCGAAGGAGGCGG
GCCGCCAACGATGATTGGGGAAGTCATCATCGGCGAAGGATTTGGCCGAGGCGGAGTCGGAGGACGAGCTGGGCCAAGATTACTCCAGTTCCTGTTTGAA
TCTTCAACATCTTCGTCATCGAGTATGCTTGAATGATCGGTGGGGGGCGGAACATCACCGCTACCACTGGGAACATCAGGAGAGTCATCCACCGAAGATT
CATTGTCATCCACGTCATCTCCATAGTCGTCATCAGCATTCCCATCGTCATCAATCTCCATCGAAAGGCCAGGCGAAGACACGCTTGGTACATCAGTCGT
GGGAACAGTCGGAGCCGACTTCGAAGACGCGGAAGCTAGTGGAGCAGCCTCAACAGGGCAGACCCTGCTGTAGAAACCACTCCCGAGCCTTCAAATGCCT
TGGATGTCGCGGCAGACGCCGAAGCAGATTTGCCTTGTGGGACAGTCTGGTTTGACTCTTCATCTTCGTCACTCGAGCCAAACATGAGCCGCATTTCCTC
GGCCTCGCGCAGAGCCTCTTCAGCAGCACGTATGTCGGCTGGAGAAGGTGAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGG
AGCGAAGGCGCGTCAGGAGAGACAGGAACATCGTCGTGATCCTCAGGGTTCACGTCCTTACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGC
TGCCTGGATCAGCAGTCCCCATGTCCACGTCACTCTGGTCGCCGCTGAGGTCGACCACTGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCA
TGAACTTGGAGAAGACGGTACAGACTTGGACCGAGTCTTTATATGACGTCGTGGCGACTTTAGCAGGAGAATGAGGACCGGGGTTTCTTGCGCTTTCTTC
TGGGCCGGCCTTTCTTTCCACCGCCTTTCGGATCGGAACAGCGGATCTAACGAGTCCGGACTTTGGGAAGTTGAA