Description :
From Genome Similarity Track
Location :
Scaffold_7:70040- 71043
Sequence
1003 bases(100 bases per row)
ATTTGCGTTTCCGCGGCGGCGTCTTGTGACTTGCTCAACTCCTGTTCGCCATCAATCCGATCTGGAAATGAGACTGGCGAGCGGAAGGTGCAGACGAAAA
TCAAGCCGTTTCTGGCAAACGAAGCTGCTAACAATAAAATTTCGCTACTGTAATAATCGCAATACGCCAGCGCTGGTTGGGGACCACCCGATCGCTCGCT
TCGTCGAGCTTCTGTATCTCGGTGGGTGTTGTGTTGAGCTAAGAAAGCTGGAGTGGCACTGGCGCCAGCCAGTCAGACCTTCATCAGGCGCTGATACGTT
AGACATGACCTGCATTTACTCCGCTGTACGGACACCCAGCAGCGCTCCGAAGGGGAACGGTTGGTCAGCATCGCGTAAGCTGCGCTCGCTGCACTGCACA
CACCGGTGTTAAATTGTACCGCGCCTCGATCTTGCCCGATGGGGCTCCCACGAGACAGACACGCACGACGCGGATGGACCCTCGAACAACCTGCCGACGA
GGATGCGCTCTGCATTGGCGACAAAGCCTTGCTGCCTCTGCGCGCTGCAGTCATCGAGTGAGCGCGGGTATTATAATAGCGAGCTTCTTCCCCGAAGCGA
CCAACGCCTCCGCAGGATTTCTCGCCCGCAAGATTAGCGAAAAGCTGGAGGACATCATGGCGAGCGGCAAAGCATAATCAGAGCATATGGAGCGCGCCAG
CGGCTTTGCCCGCGATATAGCCGGCCGCGATGATGAACACGCCGGTGGCGTGCCGTCGTTTTGACTAGGCCGCCTCAACTGGCAGACCTCGCTCGAGGGA
AGCGCATCACTTCCTCGGCAGTGAATGGCTCGGCGCAGGAACGGCGAGACCCACCCAGGCATCCGGACTGGCGTCGGTCTCCCATCGGAGGAGAGGATCG
CCATGCAGCGCCTCCGTACGTACATACCATATAGTTTACACTTGCCGAATGTAGGGCTCTATTGTCAAAATGTCCGCCGCTATTGTCGAAATATCCGGAG
GCA