Description :
From Genome Similarity Track
Location :
Scaffold_7:70010- 71036
Sequence
1026 bases(100 bases per row)
CCTCGGGGTTGAGGGAGCGACTGGCTGGCAATTTGCGTTTCCGCGGCGGCGTCTTGTGACTTGCTCAACTCCTGTTCGCCATCAATCCGATCTGGAAATG
AGACTGGCGAGCGGAAGGTGCAGACGAAAATCAAGCCGTTTCTGGCAAACGAAGCTGCTAACAATAAAATTTCGCTACTGTAATAATCGCAATACGCCAG
CGCTGGTTGGGGACCACCCGATCGCTCGCTTCGTCGAGCTTCTGTATCTCGGTGGGTGTTGTGTTGAGCTAAGAAAGCTGGAGTGGCACTGGCGCCAGCC
AGTCAGACCTTCATCAGGCGCTGATACGTTAGACATGACCTGCATTTACTCCGCTGTACGGACACCCAGCAGCGCTCCGAAGGGGAACGGTTGGTCAGCA
TCGCGTAAGCTGCGCTCGCTGCACTGCACACACCGGTGTTAAATTGTACCGCGCCTCGATCTTGCCCGATGGGGCTCCCACGAGACAGACACGCACGACG
CGGATGGACCCTCGAACAACCTGCCGACGAGGATGCGCTCTGCATTGGCGACAAAGCCTTGCTGCCTCTGCGCGCTGCAGTCATCGAGTGAGCGCGGGTA
TTATAATAGCGAGCTTCTTCCCCGAAGCGACCAACGCCTCCGCAGGATTTCTCGCCCGCAAGATTAGCGAAAAGCTGGAGGACATCATGGCGAGCGGCAA
AGCATAATCAGAGCATATGGAGCGCGCCAGCGGCTTTGCCCGCGATATAGCCGGCCGCGATGATGAACACGCCGGTGGCGTGCCGTCGTTTTGACTAGGC
CGCCTCAACTGGCAGACCTCGCTCGAGGGAAGCGCATCACTTCCTCGGCAGTGAATGGCTCGGCGCAGGAACGGCGAGACCCACCCAGGCATCCGGACTG
GCGTCGGTCTCCCATCGGAGGAGAGGATCGCCATGCAGCGCCTCCGTACGTACATACCATATAGTTTACACTTGCCGAATGTAGGGCTCTATTGTCAAAA
TGTCCGCCGCTATTGTCGAAATATCC