Description :
From Genome Similarity Track
Location :
Scaffold_26:70003- 77211
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009533Similar to Nsun5: Putative methyltransferase NSUN5 (Mus musculus)
Pytul_DAOMBR144PYU1_G009532Similar to CLV1: Receptor protein kinase CLAVATA1 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G009531Similar to HIRA: Protein HIRA (Homo sapiens)
Pytul_DAOMBR144PYU1_G009530Protein of unknown function
Pytul_DAOMBR144PYU1_G009529Similar to Os09g0567700%2CLOC_Os09g39420: Protein HIRA (Oryza sativa subsp. japonica)

Sequence
7208 bases(100 bases per row)
CCCCTTCTGCTTTCTCTTTTCGCGCTTCCTTCGCTTGCGGTTCTCCTTTTGCGCGCCCGACAACTGCTTGCGCTTCTTCGTAGTTGCGGCGGTGCTATCG
TCCTTGTCACTATCTGCTTCGTCGCCTTCACCTGCTGTCTCCGCTGGCTTGGCATCTTCTGCACTCTGAGCTCCTACTTTTCGTTTCTTTTTGTTGCTCT
TGGACGCCGATTTCGTTGCGTTTTGTGGCTCCGAAGCGCGTTCAAAGTACGCGACGAAGAAGCCGTTCGTGGAATCCTCCAGGCCGTTGGCACGCACCAA
CGCCTTGGCTTGGTCGGCAGAGAGACCGTCGATCTCCATGCCTCGTCGCGGCCATGTCTGCAGGCACGGGCGCAGCACAAACGGCCTCGGGTCATTCTTG
TTCGCCTCCGAGTTGAGCGCTGCGATCACGACTTCCTCGTTCTCCTTCTGGAAAATCGAGCACGTCGAGTACGTGATGCGCTGCACCTGCGGAAACGAAA
ACGCCTTGAGCAGCGCCTCCAGCTGGAAATCGGCCAGCGACTGCACGCGCGCCGTCATTTCTCCCTCGACGTCCTCTTCCACGTCATTCTCGAGCGCTTC
GTCATGGCCACTCGCGATATCGAGCAAGTGGTCCAGTCGATTCGTCATCCCCGACCCGGAGCACGAGGGGTCCAAGAGAATGCTGCGCACGTTCGCGTAC
TTTTCCGCATCCACGTCGATCTCCAGGAAACTCTGCAGACATGGCTCCACGATGCCGTCAGCACCGACAATCTTCATTCGACGCTTCAGCAGCTCTAGTC
GCTTTGGAGACCGATCGAATGCAAACACTTTGCAGTCCTTGTACTTTTCGGGCTGCTGGTGCAGAAGCATCGCGACGTGGCACGTCTTGTTTCCTGGCGC
CGCACACGCGTCGATGACGTCTCCTTCCTGTCCATCCGCGTCGGTGTGCTCTCCGTGCAAGATGTACGCAGGGAAGCAACTCGCTTTGTCCTGCAGCACC
AGCTTGCCCTTGGTCGCCAGGTCATTCTCATGGAGTTCCGTCCCATGCGGCAGCACGAGCAAATCGCGCACGTCCGCGTCTCTCTCGGCCTTGTACTCGT
CAATGAACTGCTGCGTTTCCTTCGGTGAGATCGTGAGCGTGTTGATGCGCACATAGCGCGGCAGCTCCAAGTCGCGCTTGCGGTTCTCCTCGGGGAGCAG
CCCCTCGTTGCTCGACACCTTGGCCTTGATCTTCATGCGCACGAGCGCCTCTTTGAACGCGTTCTGGAACTTCATCAGCTCCTTCTTCAGGTGGCCGCCG
CCTTGGATCTTCTCGCGCCCGAAGAGCAAATCATAAAGCGACACATACAGGAGCGCCGTCGAGCCCTGCAGCTTCTTCTGGAACTTGAACTGCGGCACGG
CGGCCAGCAGCTGCCGCAGCAGCGGCTTGTATCGCAGCGTCTCGCAGACGAGCGCGAAGGAGCTTCGCTTGTGCTGCACATCCTCCGCGTACGCGAGCGA
CTTGAGGCCGCCTTGGCGCTTCTCGAGCTTCTCCAGCAGCTGCGCGGCTTCCTTGTACAGCTCGCTCATGGCGTGTCGTCTTGCGAAATACGCATGTAGT
TATGCTTGGAGCTCTTCACTGGCGGCCAATGACTCGATAAATAAAAAAAGGCAATTTATTTGGATTAGTGCCAACAGTCCGATTTTAGTGACTACCTCGC
AAACTTGATTTTACAAGATGGCTACACTTGTGTTAACGGTCGATGAGGTGGCAGCGGCCATTGCGCCCGAGCGCCTTGACCTCCTCCGGCAGGATCTCGC
CTTGGACGGCATCAAACTGGTTGCCCTGGATCTCCCTGCGGCACGTAAGCTTTGCATGTTAGCCTTCTTTGAATAAAGCGGTGAATGATGCAAGTGAGAG
CCAATGCGTACAGGAACTCTAGGAAGCGGAGTTGGCTCAGCGTCGCGGGAACTTGACCTAGAAAGTTGTTTCGGTCGAGACGCAGCACGAGCAGGCCTTG
CAGCAAAGAGAGCGTGTCTGGGAGTGGGCCAGTGAGGAAGTTGGAACTCAGATCCCTGAGCATACAGTGCACCACGAGTTAGGACAGATACTCTGAGGTG
GATGGTTTGGCTGGATGCATGCTCACAATTCTTTCAGAAACCGGAGACCGGGACGAGGGAACTCCGGAGGGATAGAGCCCACCAGATTATTGTTTGCAAG
ATGTCTATAACCATAACAAGGCCACAGTTAGGATTCGAGTGAGTAGCGGCAAGGAGCAGAGTCTCCCTTACATGGACTTGATGTGGCCAGCGTGGTCGCA
CACGATGCCGTACCACTGGGTGCAAAAGGCAAATACGACAGACACACACCGAAGCAGTGAGGTGCTAACCCAGCATATGCGGTCAGCATTAATTGGGCTT
ACGTTGTTGAGACACGGGTCGCTAAGGACATTTTGGACGTCCCATTGCCGCTTCCAGGTTGGCCCTTGGGTTGCCCAATAGAGCACCTTAAGCGCACCTC
GCTCACTTCGGCTGGTTCCAACGGTACCAGCAGCATGCACATATGCACTGTGGAGCGATAGCAAACACGTCAGAAGCATGACATTGTACACAACGCTGCA
TGCTTTGATCGTGATGAACTGGAGTCGACGCATCTTGTTGTGTGATGACAGCCTGCATGGCTCAAACTAATGTCTTTCTAAGTTTAGACGAAAGGATGAT
TTAAGGAATGTACCGTATGTAAGGTAAATGTTGACACCTTACGGAACTCTCCATGTGTAGTTTTATAACAAACGGATGTCTAGAACTTGTATAAAAAGAT
ATGCATCTTCAGTAAAATACAAATTATTGCCTCAAACCTCTATAAATCGTTATTTTGGGCATCACGTATAAACCTTCGCGCTTGTTTTGGCGCGATAACG
TAGCAGCATAACCCCCAAAAGGCCAAAATGCTGCTCGAGAAGCCTGAGGACGTCAAGCACGAGAGCGCGTCGGAGAACAGTGTGTGCTGCCTGTCAGCCT
GCCTTCCCGTGCACAGTGCTTACATGCTAACGCTCCCCTTGCTTTGTGTATAATGTGTGCGCAGCGTGCGCGATCTACGGCGTGGACGCGCACCCGACGT
CGCCGCTCTTTGCCACGGCCGGCGGAGGTAGGCGCCGCGTTCTCTATTTACAACATGCGCGAAGTGCCGTAGGGCGTATGCTGTGTGTGCTTACAAACGG
TCTGTTTCTATGTGCCATGCGCAGACAATTCGGTGAAGATCTGGTCGCTCGAGCCGCAGGAGGATGGCATCGCAACGTTCGAACTGATGGCGACGCTCGC
GTTCCACCAGCAAGCCGTCAACTGCGTGCGCTGGGCGGGCCATGGGCGGTCAGTTAGCGCATCAGCGTATTGTCATTTGCTCTTTTGGCAAGGGCTCACC
GTCTTTTCCATATCGCTATGCATGTACGTCTCTTTGCCCGTAGGTACCTTGCGTCGGGCTCAGACGATCAGCTCGTGCTGCTGTACGAACTGCAGGCTGG
CGCCCCAGCTCCTGTGCCCTTTGGCTCGAACGCCAAGCCAAACAAGCAAAACTGGGTCCGCTGCTCGACGCTCAAGCGCCATACAATGGACGTGCAAGAT
GTTGCGTGGTCGCCGGACGACCGCATGCTCGCGACGTGCAGCATCGACAACACAATCCTCGTGTGGGACATCCCGATCGCGGGCATCAACGCGGTGATGA
ACCAGCCGCTTCAGACGCTGTCGGGACACAGCGGGTGGGTCAAGGGCGTTGCCTGGGACCCCGTGGGGAAGTATCTCTCCAGTGCTGGCGAAGACAAGAC
TGTGCGCCTGTGGAAAGTGGACGACTGGCAGGTATGGAGAGATCGAAACTGCACACACCAGCTCATTAAACGCGCATTGCTAAAGTTGGTGCCCACATAC
AGGAAGCTGAAGTCATCTCGGAGCCGTTCGAGTCTTGTGCATCAACGTCTCACTTCCGACGGCTCTCGTGGTCACCTGACGGATCTGCGCTTTGTGCGAC
GCATGCCTATAAATCCAAGAAGAACATCGCCGCTGTGCTGGATCGCGCGACGTGGTCGAACGACGTCAAATTTGTCGGCCACCAGGGCGTCGTGACATCT
GCACGATTCAATCCGAAACTACTGGGTATGTGTGCCATTGACAATTTCTGCGATAACCTGTGCTTACTGACAGTATGTGGTGGGCATTGTAGTTACAGAT
GCAGCTCCAGATAAGGAATTTGCTTGCTGTGCCGTTGGCGGCGACGATGCGACCGTGAGCATCTGGCTGGCGCACCTTGCGCGACCGCTCGCTGTCGTGA
AAGATTGCTTCGATGCGTCGGTCACGGATCTGTCGTGGAGCAGCAACGAGTCGATCCTGCTGGCGTCGTCACTCGACGGAACGATCTGCTGCTTCCAGTT
TGAGTCGGAGGAGATCGGGTATCCGATTTCTGATATTCGACAAAGCAAGTTGCTGCAGGCAAAGGTACAACTCGTGAAATGAAAAAATCAGGAGTGATCT
TTCTGTCTGCTGGCTACTAAGGACGATTATATGCTTGTAGTATGGTTCACGAGCAGGGATCACACTCGCATCAACGCTCGTGGAGAACCCAATCCAGCTT
CAGGTAATGCGGCGTTTTTACAACAAGCTTGCGCGGTGAATGAGTGGAGTCCATGTACTGACTGGTAGGTTTTGCTATGTCGTTGCTGTATTTTTTTGTA
GCTGGAAGAAAAATCGGCGACACCAGCTCCAGCACCATCTACCGCTTCGAACGGTGTCAACACGCTCGTACCGAAGCGTAAAACTACCACTACGAGTAGT
GCGATGCCGCCGCGACCTGGGGCTGTGAATATTCTGCAGCCTGTCTTCAAGAAAAACGACAAGAAACGGATCGCGCCCGTGTTGTTAGTGTCGACAAGCA
CTCCTCCTGCTCCTGTGTCGGTCACCACACTCTCGTCGCAAGCAACAAATGCGGCGTCGAAGGAGAACAATATTCGAAACATCCTTGGTCCAACAGTGTC
TCCGACAGTGTCCGATACACAGCTGCTGGATGCCCGTATGACGGGCGCCTTGGCCAGCAATCCCGCCCACGATGAAGAAGAAACTTCTTCCACGGCAGAA
AACCATTCTTCATCGAGTCCAGACACAGTTGCAAACCCACCACCATCTACCCCTGTACCAGCGCCATCATTATCCTCAAAGCATGATGCGAAAAAGAGCT
CGGAGTCGACCTCTCTGAAGAGAAAGCGTGACGTGGATCGAGTGGCTCCTGCCGCGTCTGCAGCAGCGACTGCCCTCTCCAAATCCAGAGAAGTGGCACC
AAGGCAACCAAAGCTACTCAACAGCAGGTACCAGCTACTGGGGATGTGTGATGTATACTTTCTAGTGGAGATGTTGATTGTATGTGTTCTTACATGTCAT
GTAGCGAGGGCGCCGGCTCAAATGGCGTTCACTTGATGCCTGAGTTCCCGCTTCGCTTGCAGTTCAATGTCGAAATCGACATCAGCGGTGTGAACAGGAC
GTCGACTGGTGCCGCGGGTGATACCCCTTCAAGCGCTGTGATTGAAGTGACTGTGCATAATATGAAGTCTCCTCAAGCAGAGGAAGTAATAGGTACGTTG
CGTCGTTCTTCATGCCACACGCTTTGTGATACGGAAACTCACGTGAATTTGCACATTAGAGCTAGGTCCCGTGTATTCAACTGTCCAGTGCTCGGCAGCA
GGTGATGTTAAGTGGATCGATCGAATCCCCGGCCGAGTCGTCACTGCTGTCGGCAACGCCACGTTCTGTGCGATTGGTGGCGATACCGGAGACTTGAACA
TCATCAGCATAAGTGGAAGAAGACTTTTCCCATGCATCAGTAAGAGCCAAGTACCGATTGTTGTCAATATGCTGCTCGCATAGCTCATATGTGTTGCCTT
GTGTAGCTCTTGGCAGTCCGTTTTCGCTGATCGAGTGCAGTCCAAAGCAGTCTCCGTACCTGCTCGTGATTCTCGCCACTGGTGCGATGAAAGTGTGGAA
TGTGACATCGCGAAAGCTGATCTTGTCGGAGACAATTGAGCCGATCACGGCTTCCCATCAGCATGACACCCGTCGCTTGACGCTCTTGAGGTGCCACGTC
ACAGTGAACGGCCAGCCCATTCTGACGTTCGCGAAGTCGAATCCAGACGCCAAAGGCGCATCGAGCTTGCTTTCGTATACTTTTGACTCGTCGATGGGAT
GCTGGTACGTAGCGTGATGAATGGCGCAACTCGTGGCACGGCATTTAACAATTATGTGATTCGTTTTTATTCGTGCAGGATGCGCGTTGCGGATGACAGT
TTTGTGTTTTCGGATTTTAACTCGTCATTACCGACCGATGCGGTTGCCGTCAAAGATATCCCGGTGCGTCAATGCATGAATAACATCAGTGTATTCGAAA
GTTACTTAAACTTGCTATCTATCTGTTGGATTCTTTTTTGCTGTAGGTTGGTCCACTTCGACGACTGCAAAATGCTTCTGGGTACAGTCGCACCCAACGC
GGCATCGCGTCGGCGATGCTTGATGGCATGACAGACGCGCTCACTCAACGCAATGTGACTCGAGCTCACCTGGAGCACCAGGTCGTCGCAGCGATTTCAC
TGAAAAGCCCTATCGAGTATCTCTACTGGTCAGTATTTTCTCGTCGATGTTTCTGTTGAGTGTATTATGTTTTACCTCGGGTCGTCTCATGCAAACATTG
CTGCCGTTATGTTCACCACAGGATCCAAGTGTATGTGCGATTCTTGGCACAAGACGAAGATGTGGATCGCCTCGACGACCTTTGTGCTGACATGATGGGA
CCATTCCACGCGTACGTATTCATAAAAGACTGCGTCTGCTTGGGTTGTTGCTATTGCATTCGGTATCATTTACTTTACTGATTGTTCATTTGCCTGGTTG
TAGGTCATCGACGGTCTTGTCGAGCAAAATGAACACTGGCGCATCAGGCGAGTGGAATCCCATGGTTCTGGTACGTTTGTTGTAGCCACTAAGTATACAT
TAGAGCAAAAGGCTGACAAAACTGATCACAACTTACAAAAACTCCATTTGGCGTGTGGTCGGTGTCTTTTGTAGGATCAACGCAAACGCGACGTGCTAAA
AACTCGCATTCTTCCAACGATGGCAACTAACCGGACGTTGCAGCGTGTCGTGACAAAGTACCAGCTCATGCTGAGCGACATCGATGCGCGTGAGGCCGAC
GAAGGCGA