Description :
From Genome Similarity Track
Location :
Scaffold_2146:70- 2995
Sequence
2925 bases(100 bases per row)
GTGGTCATCGCAGCTAAATCTACCTCTCTCAATTCATACAATACCACGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAGCTGCCCA
AGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCACTCCCTCCTTGGAAACTCGATG
GCCTAAGTAATCCGGGATGTCACTCTTTCGCACAGCTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACG
GGGCTCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGATCTTCCTTGGATCCACCCTTTTCGGGTTCCGGTATTCGAGTGAATCC
ATAGAGGGTGCTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAGCAGTCCAAACGGTGTGATGAAT
GCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACA
GCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATACCCACCCCGTTCTTCTTGAT
GATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCACTTAATCAGATCCGATAGGTTTTCTCGGAACTGA
GGCGCCATCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATTGCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTAC
CAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGAC
CTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCT
TCCGTCTTCATAGGATCCACAATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGA
AACCAACAGTTGGATCTAGTAGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATC
CCATGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCCGCGTTATCTAAGGGC
CGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCCTTGCTTGGATCTTAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAG
GCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAAATTCTGCCATTCTTT
GTAACGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCCGTAATAGTCTC
ATATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCAT
GTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAA
CGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATC
CCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACGCCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCGTTCG
TACGGTACACACCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACAC
CTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGAGCATGGTACTTCCAG
TATCCACGGGCTCCCCGGTTAGCAGATCCATGGATCCTGCATCCTCAGATCCATGGGATCCAGTGACCTGACAAACTTTAAGGGGATCCGCCGTGACCTC
ACCCTTGCTAGGCTCAAACCATCGACCATGTTGACGCGTCTCCCAGTAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTG
GAAAACTCATCCACTTGGCGCAAACTAGAGATCTTGACAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGAT
CTAGCGACGTTTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCG
GCCACTTCTGGCAACATCCCTCCGTGTTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCT
CGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCATACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTG
CTTCCGGGATCCGCACTGTGAACAC