Description :
From Genome Similarity Track
Location :
Scaffold_793:70- 2448
Sequence
2378 bases(100 bases per row)
accTCGCAAACGCTCTATATACATTGAAGCTTCACCCTAAGATTCCCGACCCTAGAGCTTTTGCCGCGAGGGGCGAGGAGGATGCGTAATATATGCTGGT
TGACCCATCCCCaaaggtgctgcagccagtACCCAACAAACAACACGTGCACACCCACAGACATCCTGTTGGACTGCTGAATCGGCCCCCGCAACGAGGA
ATCGATCTTCCCGATGAATGTGACGTCGATAATAGAGGTTTCATCCATAACAAGCATTTTTAGCTGAGCGAATTCCTCTTTCTGCTCAATAGTATATCGT
TGTTGGCGCCTCTTATTGTTCTTCACGCCCCACATGAATAATCTAAGAACCGTTTGGCTGTTTGTAGCTTAAGCGGCCACACCTTTATATGCTACTGTTT
TCAAAGCATCCCCCCCAGCTTTTGCCAAAGCCTGTAGAGCATTAATACCTTGATTTTTTTCTGCCCTGGTAATCCATCTAAAAACACGATGAATTGCTCA
ATGTGTGTGGGTTGAAGATATGATTGATTCCAAAAACTTATGCGGCGAGCACGAACGCTTTGTGCTCCTTTCGGTTGAATGAAAAGTGCAACGAGATATT
CAAAATTGAGTCATTTATCGTTGGGTGCCGACACGGGCACGGggacttcttgctgctggtttaCGGACCAAACACACAGAGatgcttgctgctcgtcctc
cacccGCTCGAATTATTGGTTGTGGTAGGTTCCTAACCATTTATAAGAATCTATAATTCCGATGACTGTCTGACCGGCTATTCTGGGCCGGATCACTTAA
TTGCACCTTGCTTGAACAGCAACCATGAACAAACGAAGAATTAAATATCTCTAGTCTGACCCCCACCGCCAATCGGCCCGGTCAGAAGATACATCTCGAT
CAATAGGATTGGATCTATTTGGCCTTCTTTCGTTTAGGATTAACCACGGAGTAACGAAAATAGGAATACCACGGGCAATAAACAGATCCGGAATAAGTTC
AATGGTGCGCAAAACGATATAATATTCGAAAGGAGATCAAACCACTGGCAACCAACGCCTCAGCTGACAGTCCAGCGATACCGTCATCGCGCCGACTGCA
GAATTGGCTCGACAAGCCACGACAGCGAAGCGTGTAGCTTTATCGCCACAACAGAAGGGCGCCTGTCCCCACAAGCAACACCCTCGTTCTGTCAACCGGT
TTCCCGTCTCCGCCGAGCCCCGCGCATCGCTAGCTTCAGACACTGAGGTGGTTTACGTTGGTGCTCACGATTCAGAAGGCAGGAACAGCAGGCCCGTGCA
GTGGACACTCTCTTCTATCTGCACAGCTTTCGGCTTGCTAGTAGAGGCTTCTACTGATGCACCAAGGCCCCGCGCGTCTGTAAGCTTGTTATGCAGAGAC
TTTCGATGTAGCCCTTGACATTCACAAGTATTTGGTTGCTGTGTTTCCCTCGTTACGGAGGATATTAATCATGGCAAGGGTGCAGAGCCCACGACTAGCG
CGTCAAAGAAGGCAGCGTTCTTCTATTTGGACTACAGACAAGGTACATCAATATGCTATCCGAGCGACGAGTGCTTTGTCTAACCTAGCTATTGCGTTTA
CAGACAAttgagttgctgcagcttcgcttcTAGACAGTGGATATATTTGCAGCCTTTCTTAAAAAaagcaacgacgacggcgaaATTGGACGGCGGTGAT
GTCTAGACTAAGCACTACACGGGACTGGGAATCGTGTCGCCTGAGACTCAAGACGCTCACCTCACAGTACAAAGtaagttttttttctctcgAAGGTACT
ATATAGTCGATGCGCTACTAACGATGTTTGCTGCTGTTATAGAAACTCATGAAGGAACACACACGAAGTGACAATAATACAGAAGACGACATCACGTATC
CTGCGTACTGGGATACAATGATGGAAATATTGGGACCGTTCAGTGGTCTCAACGGCACTGTCATCACTGACAGCGAGAGACATCATGCGACAGCTTGCTC
CTCAGCCGCCGTTAAGGAAGCCATGACAGGATCTGATAGCGATGAAGGGCAAAGGGGGGGGTGCTCTTCAAGTGGTGACCATGATGCGCGGAGTCCGAGA
TAGTGCTGTCCCCTCCATTAACAGTGTGAAAATTGtgggagcagctcgaacatGAGGACACAGATCCGACAAGAGGTTTACAGTCTTCTCCCTGGTCATG
GATGCTCCAACCAAAAGATCAAGAATGGCTGGTGATATATATACGTTAGCATCGCCAATGCCGACACTGGTGGATCATATAGTGGGGAAGCCGACAATGC
AGGACAGTAGAGAGCTGAGGGGGGAGAAGGAGACGTTCCAGAGGAAAATCATCGCCGCCGaggtgacggaggaggaga