Description :
From Genome Similarity Track
Location :
Scaffold_802:70- 2242
Sequence
2172 bases(100 bases per row)
GCCGAGTTTGTTGGTGGAGCAAGGCACAGCCGCTGCCCGGTTTTAAGGGAGACAAAAAGCACTGAAGTGATATGCAAGCGTTCAACTGGGTGGTTCGTGG
TCAAACTGTCATCGGATGTGTGGATGAACATTTCAAAAGAGCACAATTTGGGCGTCCCAGTTGACACTTTTGGGCGTAATTTTAACATTTGCACTGACAC
CGGTTGGTGATCGGCACGATGGACTAGCAGTCGCTGATGATATAGAGACAGTTATCAGACAAGGACTTGACGAGGGGTGGAATATTGGTGCTATCATTTA
CTGATAACGCCGGGACAATGTGGGCGTGCGCGGCGTATATTGGCTCTTAGGTGGCCACAGCTCGTTTTTGTGCGCTGTTTTGCGCATGACATTAATAATC
TCGTTAAATCGGCTCTACAATCGGTGTTTCGCGGAGTAGCCGGCAAGGCAGCGGCTGCCGTTAATATCATCAACCAATCATCTGCAAAGTGGCTGCAACG
CGTACGAAGGCTAATGAAGAGGTTCTACGACAAGACACTTGGGTTACGAACACTCTGTGCAACTCGCTGGAGCTCCATGCAGGGCTGCTTCGCGTCACTT
CTTCGAGTAAAGACCGCTCTTCAGATGCTTCACCACCAGTACGGGATGGATAGCGACTTTCCATCGAGTCTGCGCTGTTTAGGTGATGCCGACTTCTGGA
CAAGTTTGACTAGTGCTGAAAATGTTATTGCACCGTTGCCGTACGCATCGTACAGACTCCAGCGCGATGAAAACACTGTTGGTGACGTAGTGATATCCTA
TCGTGATATTTACCTCGGATTTCGGAATATTGCTGGTAGTTGTGATGAGCTCGTCAAGTGTGTCGAGGAAAGATGGCGGCAGTGTGAGCAACCGCTCTTC
ATGCTGGGGTTTGCACTGCATCCAGCGTATGCAGATCACGCTCGAGCGCTGCCGACTACGAAGGTCTCAGGGTTGGGCCGCCTTCCTTCAATTGCTGTAT
ACTATTATCGCAGGCTATTCTCTACAGAGGATGTCGGCGTCATTCGAAGTGATATGCTCGACTGGATGGAAGGCAAGTTCACAAGAACTAAAGCAAGTGA
ATTTAAGGGCTCTCCCTGGAAATATTGGCGATGGGTTGGCCAACAAAGACCAGACAGTATGCTACCAAAGCTTGCGATGGCAGTATTATCCATTGCTGTC
AACACTGCTACATGTGAACGACTATTCAGTGAGCTCGGGCTTATTCATACAGCACTGCGCAACCGCATGAAATCAAGCAAAGCACTTGACATTCACATCA
TGCGAAGCATGTTCGTCAACGATCATTGAAAAACTCGGTTCAAAATGCAAACAAAAAGCAACTGATATCACCTGTGGAGCGTGAAATTCTTCGCGAGGGG
CGCAATATAATGTTTGTCCCTTCGCCACTAGGCCCGCTGCATAGCACGGATGAAGACGGTGACGAAGAGGATCCTGGTGACGGTATCAGCGATGGAAGAG
CTCTCGCGGTTTGGGCTGAATATCTGGAGGAGGTTTTTCGTGATGAAGAAATTGACTCGCGGTATGCTGCTGCTCAATACAGTGTGCCACGTAATTGCAT
TGACGACGACAACGAATTTGAGGCTATCCCTACGGCAGTTAGCACGAATTTCCGGACGAGAATGACCCTGATTTCCCCCAAGAAGAGCTGCGTGGATTTC
GTGCTCAAAAGGCCACATTAGAGGATCTTTTCGCCCCCCAAACGAGCGAGTAGTGGTGGTATCAGTCAGTTAAAGCTGAAGAACACGGGCGAAGAAACTT
TCAGCCTTACTACTACCTCGAACCCAAGTGTTTGCCGTGCTAGTCGGAACATTCGCATATGTCGTCAACATCCAATTGAGTATTGTGTGGTGTAGGGATT
TCCAGATTCGACCATACGCCAACCTACTTTAGGTCAAGAATCGGCACGGTCTGATAACCCAGAGTTTAGGAGCAAAGGATCACGGTAAGTACTCGGCGAT
CTGTCCGGATATGCTATCCGGATGGCTGCTGAGCTCAACGGTCGCCGGAACTCAGCTGAAGGGTCGGTAGAGATCCGAAACGACTACATTTCACTAGATA
TTTGTATAAGAAGCATAGGATTAAATAGGGGGAGCCGAAATGGCTCCCAGAAGATAACAGAGCAGAATTTTC