Description :
From Genome Similarity Track
Location :
Scaffold_1005:70- 2180
Transcript NameFunction/comments
g14885.t1hypothetical protein
g14886.t1hypothetical protein

Sequence
2110 bases(100 bases per row)
CAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGGGGGCCGCATGCACCACGTGGTGCATG
TGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTTCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTA
CGATACGCTTCTCGGTTCTAACAACGACACCCGTTTCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGTCTTGGAAGGCT
CTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTG
TCATCTTGCTTCTTGCAGTGAGATCGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGC
GCCCCGCGCCTGCTGGTCCCTTTAGTTTTTGTATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAAGTTGCTCGTGGACG
TCGCGGCATATGACCGGACTGTTTTCCGCAGCCCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGGCACAGCGCGGTCGCACTCGAGGAGGGT
CCATTGGTTCGGGACCTGCCCGGCGGCCTTGCCACCGGGTCGTGGCATTTAGCGTGGGCGTTCACTGCAGTTTGCCTCGCCGCAGGCTAAACTCTTTCGT
TGCATTCGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGAACGAGAATAGGTCTTCACAGGCCCCATCTTAAGGCCCTTCATGACGTGACG
ACCTTTTGTCGCCTCGTCATATCGGGTTGGTCACGATGTTCGTACGACCAAGTACCGTGCTCTTTGGCGTAAAGCATGCAGCGTCATGCTTGCCCTGTTC
GCAGATCGCGAACTCCGGGCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGT
AGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTTGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGAGACGTCGA
GCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTACCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCG
GTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTTGCCGTCGGTGATAACGTC
CAAACAATCTTGCTACCGCCGCTTCCCCAATGACTGTCGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAAC
ATGCGTTGCAGACGTGTATGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCTCCGCGTTCGTATTCCATACGAACGTGTTAGTCTGTC
GTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGTCTGCTTAGACCCACTACTTAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAA
TTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAATGAACCGAACGAAAGCTTTGGTGTAAAATGAGAACTGTATTGATTGT
AAATGGGGTTTCCTCCTAAAAACTGATATTTTCAATGAGAGTCTGCCCTTGATGGCTGGCAGAACCCTATCTATTGAATGACTCTCTTGGGTAGAAAAGG
TGTTAACTTTCTACCAGTCATATGCTTTTTGCTTATGAATGTGGACACCTGTTGGTGGTCACTGAATGGTGCGGGCCTTAGTGCTTGTTGCACTCAAGGG
TAGGGAGGTG