Description :
From Genome Similarity Track
Location :
Scaffold_1696:70- 2092
Sequence
2022 bases(100 bases per row)
TCGTACAAAGTATCTGAGATTTCTAGCATTCGTCTCCCATGTTTTCGGCGGAGTGCTAGAAACAATGATACATTCATGCAGATCCCGAATCCACCGACAG
ATGAAATGATCCACAGGAACTCGGTTGGGAGCTTCATAGGAAAACGGCGAACCAGGTTGGTGGCAGTCAAAGATCTTATTCGTCTGGCTACGGGAGTCAG
GCATTGTAGCTTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATTCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCA
TCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGA
CACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGTCCCTGTGAACGTG
AAAGCTCGGGATCCAGTACGCCCTACGCGCGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGG
CTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAATGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTTGAAGC
TGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGGGACGTGGAGATGGAGTCA
GTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCACAGCCGGGGCAGGTG
GATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTTACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAG
CAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGG
CAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACGATACTACC
ACGCTCGCCCGCAGATCGGATGAATCCCCGCTGAAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCA
AAGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTTCAGACGCAGATGAGCT
TGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCATAAGGCTCCGACGCCTACGGCC
CCAGCTCGACGTGTCCACCAAGTCACGACGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTC
TCACTGCATCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGACCGTGGGATGTACAGATCCCGAGATCTCATG
GACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCACGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATC
CAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGG
CCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCTAGGAACTGGTATCGGCAGCTGGGCAGATC
CACCAGGAACAAGTGGCCAGAT