Description :
From Genome Similarity Track
Location :
Scaffold_2067:70- 1991
Sequence
1921 bases(100 bases per row)
GCGGCTCTGCGTGCGAGATTGAAGATCAAGGACGGAGATTCCAAGGCCCGCCGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGAACTGG
CCGATCGGCTCACTCTACTCCGGCTTGCGGACGCAGCAGATCTGGAGGAAGTCCTGCGCGCTCGAGAGCGCGCGAAGAGCAGACAGAAGCGATCTGTCTT
TGGATCGAAGTATCGTCAGAAGGTTCCAACCTCAGCACCAGCTGCTGCAACTAAGCGGGCAGTGCGTGCAGTGCAGATCGCGAGCCAGGTATCTGGATCG
GACACGGGATCAGACGGATTGGACTCGGAGGGTGATCTACGTCGCGTTTACCTAGCGTCGGCCGAGGACCAGTCTCGCAACGCTGGGGGCCGACGCGACG
AAGCCGGATCGAAGCAACCAAGCGCAAATCAACCATGACTCGCCTCGATCGGATCCACGATCGCGATCTTCACCTGACGGATCGGAGCGATCAAGCCGCT
GCTCACTCTGTGGATCGCGGAAACACACCGATCTCGATTGTTGGAGACGTTTGACGTGCGAGAAGCGTGGCAAGAGAGGTCATCCGGCGGATCGCTGCCT
GTTTGTGTGCCGTGGATGTGGTGAACTACACGAAATGGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGTCAATGGTTCAACCCGGTGAAGCAC
GCTGGCATGTTGCCAGCGATCGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGATTCCGGTACGAGCCGAGCGTTCTAGGTACTGCATCTATGC
ATTCGTGAACAAGAACCCGGTAGATCGAGTAAGTGGACAGACTGATCTACGCGGTACTACATAGGATCTGCATGCGAAATCTGCCGCCAAGGTCTTAAGT
CTACATCGGTCGGACAACTTCAGCCGTTCTGACGCCGAAGTGCCCTCGGATTTCCAGTCTGGAGAACCGCGGGGCTATTGGAAGCAACGTAGACCGGAAG
AATGGTTCAAGCCAGCTGATGGAGAAGTGACGACCGAGATCCCGAAGCATGATCGCGATCGAAGTCTGCCTCGCATCAGCGAATACCGCAGATCTGGCGA
TGTGGTGCCCGATCTCCTCCCTGGGGAGTCCAGACGGTACTGGAAACATCATTCGCCAGGTAAGTGGTTCCGTCAGGCCAAGATCACTGGCAAGATCAAC
AATGAGAAGTCGATCTTACTCTTATACACCGGCGCCGAGGTGTCCATCGTGGACACCGCCTTTGCTCGTAAGGTGGGGTGCTATGTCGACACGAAACAGA
GCCAAGAATGTGTGGGGATTGGCGAAAGCGTGTACATGACGGAAGGAAGGACCAGGATCAAGGTTACACTGGCGGGATCGCTGGTGTATTTCTTCGATAT
CTGGGTCGGCGATCTATCAGGACAAGAGGCGATCCTGGGTATGGACTTTATGGTTCCTGCGGGGATCCGCCTCGATCTGGCGGATGGCTCTATCTGTCTC
CCCGACGAAGTCAAGATCCAGCTTAGTGGACGGCGTCAGCTGTACAACGACAATGTCAGACACGTGTGTGTGGATCAGGGAATGCAGATCGCGATCGGGG
ATTCGATCGAGCTTCCGCTGCGAATGAAGGCGACCGATCGAGAAAAGATATGGGTCACCCGTGGAGATCGTTGGGTGCCAACCGTGGTCCGAGGACCCGG
CAGAATCAGATATCTTCCAGGTTACCAACATCAGCGACAAAGACCTGTCTCGCATCGGAATGAACGGATCGGGATGTGGCTGGCTGGATATCGGATACCC
CGGATCCCAGGATATGTGTCGATCGGATCTCTGCGATACATGGAATGGCAGCATCTAGCCTTTCAAGCCACGACAGATGACCGGCCGACGAATCAGGAGG
CACCAACGGGACCTCCAGTAC