Description :
From Genome Similarity Track
Location :
Scaffold_1649:70- 1717
Transcript NameFunction/comments
Phyta_totarag13423hypothetical protein PHYSODRAFT_257049

Sequence
1647 bases(100 bases per row)
TTTAGTTTTGTCTAAGTCTAGGCTACCGCTATACGCCTGGACGGAAAAGGTTCACCGACTTCGTCACagctggtgcgcgtgcccggatTTGGAGTCCTCG
GATTTCACTGACTTGTTATATTTGTAGGAATTGAAGAGTAGTTGGGTTTCGTTAACTTCTAATCATCTCTATGGCTGGAGGGCGAGGCAAGAAACAAGGA
GTGCGCGAAGACGGAGGACGCGGTGAGGCGTCGCGTCAATCGCGCAGAGTGCAAGGGCTGCCCGCCAAGGAGCACAAGGACCTCGATCAGGTGAATTGGG
AAGCGCGTACAAGGTGGAAGGCTGAGCGAGACGCTCAAACTGTGGAGACCAAGGACCAGACGGTTcctgaacctgctgctcaaggtaACCCAGTGTTGCT
TGGAACGGCGGAGGAAAAAAAACCGCGTTCAAGGTCGAAGGAGCAGAGTGTTGGAGGAGAGCGGGTTCAGGAAGTTGACCCTGCACAGGCGTCTGAGGGA
GGCGCCGATATGGTTGAGCCTCCGGCGGCGGATCGAGTTTCGGACTCTTCGCCGCCGGTACAAGGCATGGAGCCGTCGAATGCAGTGCAgatcaaggagg
aggagtcaAAGGCTGAGTGCGTCCAGCGCTTGAGGACGCGAACACATCTGCGCTCGCCACAATGTCCGTCTTCCTCGCCTGAGCCTCCAGTTCAAGAATC
CCCCTCTGAAGTGTTGCCGGCCAGTGACGCCTCAAAGAAGTTTCAGCCTATGAGACTCTGGACGCAGAAGTGCGTCCGAAGTTGGAAGATGAAACGAAGG
GCTCCCGACTAGATGAGGCAGGAGCGAAGAACTTCGTGGCCCGACAAGGCTATCGTTGGGAGCAGATGTGTTATGGACGTGTCACACCACCGAGAGTCGA
GTACACATGGCCGACGCCGAGACCAGACTTTTCGAACAGGTTGGAAGCTACAATGGCCACGTCGGATTATGTCCGAAATCGAATGTCTCTGGAGTCTCGA
GATGCAGCTTGGATCGCCGAACTGCACCCTGAACGCAGAGCGTTGGGCACCGCTGAAGCTCTGACCGCTATTGCTATTCCGCCAAGTTTGCTGACTCCGC
TAGAATTTGTTGCCGTACTGGAGACACTCCTTTTTGAAGCTGGATTCGAGTTCAAGAACGCCATTCCGGATTGGTTTCTGGCGCACGTGGCCAAGATTGG
ACCTGGACTTGTGCGTTCAGTGGTTGAAGATGTCCAACAACTTCTCCCCATTGAGCTTATTGAGTGAAAACAGCTGACCGCAGGAGTGTCATACGAGGTG
GTTGACACCCCGGACGCACATGAAGCTGGAAATGCACTCCGAGTTTTAGACGCTGAAACGGAAAGTGCGTTCAAGAAGGTCAGGTCAAcgtgatgaagca
gatgaagaccTATTGATGTCGGACTACGAGGTAGATCTGCTGGGACGTGACTTCGTCTCGCAATGCAGGATGGCTGGGATCACGGTTCTGCATAGCCTGC
GAGGGCCAGCTGAAAGTGATCCTGATCCAAAGCGGCCTTAATGCAGACCTGCACGTCCACTCAGTATTTCGACACCATCTGAGCATTCGTTACTCCCGTC
GACAGATGTAAGCCTGAACACGGACGCTCAGGCCATGAGCATTCAAG