Description :
From Genome Similarity Track
Location :
Scaffold_945:70- 1431
Sequence
1361 bases(100 bases per row)
CTACAACTAGCCGTCACTTATTCTTTTGGACCCTTGGACGGTGGGTCACACACACACTAGGCTCACTCGAGTCTGAAATTCAGGGGCCTAGCTCCCCTGA
GACTCACACAAACGCGCACCACCTCCAATAAAGGAGGAAAATACAATCACTATCAGTTACCTTCCCTTTACACAAGCAGTCAATACAAAATCCTGGAGGC
GACTACCTAGCACCCCAGAATACCCTCTGGAATAATATGAAATGGGCTACCACGAGCACAGCAAGTGACCCAACTAGGATATGGAATAGATGGATCACCC
CAGGAAGCTCAAGGCCGTCGCTGGTCACCACGTAACTGGGCTTGAGTTTGATGGAGCCCACACAAACGGCTGTCCTTCACCGTTGCTGTGCCCTTAGCGT
CCCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCATCGGCAGGCTTTGCCGAAGTCACTTGCGCAGTACAGGGTAAAAGGAACTCTGGTTTTTATCAGCT
ACTTCTCTCTCTCTCTCTTCTTCGGGCAAATATCTTCTGTTCACTATGCTTGGGGTCAAATGTCTTGTCTTCAGTATACCTTGGGTTCAGCGGTCCAAAC
TTGCGATCGGCTTGCGAATCTATTGTCGCACGGCGTTGAAAGTGCCAATTGTGAGTCCTTAGACTTGGTTTAGTATGATGCAGGACTCCCTCTCGACTCC
TTGAAAGTATCCAGTCTGCGCATCCACAAGGGTTCTTCAAGGTCACGCATCACTTTGATTGCAGACTGGCTTCGAACTGACTCGAGTCCCTGAAAACCGG
GTGACACTCAGGGTCATCTTCTGAAATCCTGGGAATTCTGAGGAATCTTGGGGAACTGTGGGGATTTTTGGGTGTTGACTCGGGAAACACTTAAGTTCAG
TATAGAGAGTCTGGATTTATGGTCCAAACCCAGAGAATCATCTTTGGAACTCTGGGTCACCTGCACTCAGGGAGGTGAACTCTGGGTCATCGTGCGGCAC
TCTGGGTTTCCGTGCGGCACTCTGGGTAACAAGTCTGCTGCATTGCAGGCTCGTGTGTATCCCCACAAAGCCACACTTTTAGTGGGTTTAGCGGCCTCCT
GCGCATGATCATGGTAGTAGTGGGTTGATTCTCAGGGTAATTTGATCCTCTGGGGCACTCTGAGCCACAGCAAGATGAGGCGTACTCTGGGATACTTTCT
CCAGAGACACTTTCCGCCAGACTTTAGGCACTCATCGTAAGGGAAAGTCCGCGGCTGGACTGAGTGTTCTCTGAAATCCTGGGTGTGCACTCCCAGGATT
CACACTTCCAGCCAGTTGGGCCCATCTGCGGTCAGGCGCTGGACTCATCCCGAGAAATCAC