Description :
From Genome Similarity Track
Location :
Scaffold_3878:70- 1314
Transcript NameFunction/comments
Phyin_T30-4PITG_22535Putative uncharacterized protein

Sequence
1244 bases(100 bases per row)
GGCTTGAATTTGGAAAATGGGTGCCGTGCCCATAAGAAGCCTAGGCCCTGACCAAAGAAGCAAAATGAGAACAAGCTGCAGGCAAACCTAACGGCCACTG
CCAATTCTTGGCTTGTTGGAAGACCAAGATAACTTAAGCCCCCATGGAAAATAAATGGGCCGATCCGGTTCTTTGTGAAAGTATGCAGCCGATGGTGACC
ACCAAACTTGCACAAGGCTACGAGGAACCTCGCGAGTGGACTCTACACACCGCAGAGTCACTGGCAGTGTCACGAGTGATGACGATGAACCCAGTGCAAA
CATCGCTGCTGGGAGCATGGCGCGCATGTATGGGAAAGGATTCTTCCGCAGCGTCACCCACAACAAGATGGGGAAGAAAACCAGCTCAAAGATCACTATC
GAGAGGACCGTGCACAGCACAAGTATACCCACGTGTCGTGCAGCTTCGCCCAGCATTTCTTGTCCTGATAACGAGCCGGCCACGAGTGACATCACGGCAA
GCGGGCTCCAGTCGATTGCCTTACTAATCACTCGAAAGAACACCTTGTTCATTTGCTTGAGTACGTCAAGTAAGGGGCTGCTCTCGCGAGAACTAGTTTT
GACTGCAGCAGCTCCGAAGGCGATGGCGAACGTGGTTACACTCAGTATCAGATCTTGCTCAAAACTCGAGAAAATATTGGACGGAACGAGCTGGTTCAGG
ATATCCGTGATTTGCATCGACACGGTAGCTGCGGTACTAGCTGTGCCATCATTCAGAAGGACCCTCGTGGGGTCGAAAAACTCGAACCGCGTCGTGCCGT
CCTGCGAAGTCGCAGAACACAAGGCTGCGCCTGTGTAGTTGTACGTGAAGAAATTACCATTCTCGCACAAAATACTGAAGAAAGCCGATGAAGTCTCCGC
GACTACGCCCTTCGTGTGTGGCACAAGATCACGCAAAAGCATTGAGATCGAGAGTGACAGCGCCGATCCTGTGAAAGACAAGCCCGTGAATATCAAAGCT
GTGCGAGTACCGACGATTGATACTTTTCCGAGCAGTACGATGTCAGCAACAGTTGTGGACAAACTTGTGAATACCATGGGGATCACGAAGCACTTGAGGA
CCTGGAGAAACACTTTTCCCGGCAAATTTACGAGAGTGCCGACATTGTCCGAGACGTCCAGGTTGGCTAGAATCATACCCAGTAGCAGACCAGCAATGGC
ACCTAGCATAATCTGTGTCGTTGGTTCCCGCAAGAACGCGCATC