Description :
From Genome Similarity Track
Location :
Scaffold_1673:70- 1281
Sequence
1211 bases(100 bases per row)
GCCCCCCCTTAAAAAGGGGCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTAC
ACCACTACCATGCTAGCCTGGAAGGGGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGT
ACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTC
CAAATCATAGCCATGGATCATATCCCCTCGTTTCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGCTTACCGGATACGTGATAG
CCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGGTAGCGAGATGATTAGACATGATCG
GGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACAGATCG
GCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTTTCTTCG
CGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTG
CAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGAGTG
CGATACAGGGTCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGCGTGAAAGAGGG
GTATGCCCGCAAATTAGCCCACCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGAAGAACATGCGGTAAAGCTGGAAACGGTAGGTACCGAATAC
CGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTGGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCG
ACTTCGACGAA