Description :
From Genome Similarity Track
Location :
Scaffold_1521:7- 3850
Sequence
3843 bases(100 bases per row)
TCGACATCCCCGTGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGACTGTGCATTGATTACCGGTTAGTTAACGGCCTGACTCG
ATTGATGGTGTATCCAATGCCCCTAATCAATGAACTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTG
GTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAATGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCC
AGATCTACGAACGCCTGATCGATAATGCCCTCTACGGATTTACCCGAATACCGGAGCTCGAAGGGGATAGATCCGGGGTAGGTCGTACGGAAGTGGATCC
ATTCGAAGCAGGAGGGCCAGGGGATCCTGGTGATCCATCTGTGTTAGAACGCAGATCCCATATCGACGACGTTCTAATCCCGGCGGAATCGTGGGATCAG
TTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAATGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACT
TAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTAGCCGGCTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATC
CTTCTTGGGCAGTTTGAACTACTACAGTCGATTCATCGAGGATTATGCACTGTTTGCTGCAGTACTATATGAATTGAGAGAGGTAGATTTTGCCGCGATG
ACCACTTCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCGGATCCACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAA
AACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCG
AGCTCAACACGCATTCGTGGAACTGAGGAACAGGATTGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGTTTATGCC
AGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACT
ACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTC
TACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTCTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCG
AAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCACGAGCATTACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCA
AACGCCGGACCCAGATCCCGATCCCGACGGTACAGGTGGATAAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGACATAC
AGACGCGGAGGGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTTAACGAAGC
AGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTG
CGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCA
AGCGAGATTGGAATGCTAGTGCGGATAGCTTGGCCAGTGCCGCATATGGAATCAATGCGGCGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTT
ACGTTGAACCCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCAGTCACGAGGTCCAGAGGAAGGATTGGATCCAGT
CCCCAGATCCTCGAGGAAACGTTTGTGAAGAGAGTCCGCATTGGGCGGATCCTCAAAGCACAGGACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATC
TGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTG
CCCCCCTACGAAGAGAGTCAACGAGGGTCGGGATGGATTGATGAGACTGGTGATGCCGGAGACCTTACAACAGGATGTCCTACACCACTATCACGCTAGC
TTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTACAACGATATGTCGGTG
AATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTTCAAATCATAGCCATGGA
TCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTAATAGCCAAAGCTAGTGCGTCT
ATAAGTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGGCATGAATCGGGAGCCAGGCTTTATG
TCCGATTTCTTTCGAGCATTCAACCGGATCCTGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCA
GACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAA
GACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGA
ACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGTCGAGCG
AATCGACACTACGAAGATGTCCGTCCACATCAAATCCAAGTGGAATCGCAGGTGTGACATTATTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAG
CCCACCTATGGCACGGACCCTTCCGGGGGTGAGCGAGAGGATGGAAGAACATGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTGTG
GTACACGTATCCAAGCTGAAGTTGGTCAAATAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCC
TCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGACATGAGGTCAGGGAAGCGAACTAGATACGGACG
GATTTACCGTAAATTTCTGGTGTATTGGCGTGGATTTGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGAAGCATTACTCTATGATTTCTTG
AGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGAAAAGGGATCCATTGATGTGAGTTGGTCATATCGATGGGAGAA
TGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG