Description :
From Genome Similarity Track
Location :
Scaffold_1803:7- 3613
Sequence
3606 bases(100 bases per row)
AGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCACATCCTTCCTCACTCCAGCTGGCACCATGAAATCCATCCCAAGGAGGGCGTCTT
GACCAGCGACATCCCCGATCCTAATGTCAAACTTATACACCAAACAACCGGCCGGCGTGATCTTATTTCGCGTTCTCCCGTTTGTACGGTATACGCCTTT
CCCCAATCCCAACACATTCTTGGATCCGACTCCCATTCCACTTGTCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACAACCTCGGCACCACTA
TCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGACCCACTTTCCTGGGGCATGGTACTTCCAGTGTCCACGGGACT
CCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGCCCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGG
CTCAAACCATCGAACATGTTGGCGTTTCTCCCAGTAAACACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCC
ACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCT
TGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGC
AACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGC
GACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCC
GCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATATCCCGACCGCGAGTTGTCT
CCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGT
CAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGGGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTG
TTTCGCGCGATCCACCGCCCGCAGCACTTGCTCAAGCTCGTCTGCGTCGGGAAGACGTTACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAATGTC
TCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTCAGTCGATGTAGGTATT
CCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATTCACAGTACTGGGTCTGGAAACTGCGCAGCAAATC
TGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGAC
GCTTGATCTCTCATGAGGGCCGACTTAACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGG
CTGAGATCCGTACTCTCTGGATCATGGACGATCCACCTGCTCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCCTCCAGATCATCTGG
GTCGAATTCATCATGGGCGTTGTTCTCCCTCCACTGACTCCATCTTCCACGTCTCGTGCTCCATGTTCGTGAAGCATTTGCACTTGTGGCACGAGCGCTC
TCATACACTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGAGTCGCTGCAGAGTGCCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGTTCCA
CTGGCGAGACCGGATCCGTGAGGCGGTTACCTTGAGCCCGATCTGACGATAACCCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTG
TCAGATCACGCGTAGGGCGTACTGGGTCCCGAGCTTTCGCGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGA
GGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTATCTGACTCATCCTCCGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGTGAC
GACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGA
AGATATCCTCTGCGTCGAACACAACAAACTACGAAGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTG
GTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCCTGGTGGCGATA
CACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGCT
TTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGGTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTT
TCCCTTGTTTTGTTAGCGGATCTTGACTTACGTAAAGATCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCC
GGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACG
ACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGT
GTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTG
CTGAACTTTCCTCACCTTGTGTACCCATCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAG
ACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCT
AGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGCTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCGGTGACGGGATCTTGA
GAGTTG