Description :
From Genome Similarity Track
Location :
Scaffold_1122:7- 3470
Sequence
3463 bases(100 bases per row)
GTATACATTGCGCTTGCGCTCCTGTACTGGATTCTGAATACGCTATTGGCCGCTCTTGCAGACAAGTGGGAATCGCATTTCCCCAAATATATGAAGCGCA
AAAATAAATCAGAGCTGATCTAGGGACTTTTCCAGCAGGGAGGGGATAGAGATGAATAATACTGTAGCTGTAGAGGTAAGCGGGCTGCAAAAGAAGTTTG
GTGACCAGCTCGTGCTGAAGGGTCTCGAAGACGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGG
CAACGAGCTTCGGAGAGGTTCAGGTAGTCTACTCGCGGTGGCGTGGATTGACTACAAGTGCTTACAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGA
GGAAGTTATCTTCTCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCAAAGGTCCCCTCTTTAGTTAAAGAGAGCGAAGTGACTCTAAATAAGGTAGAT
TGTAAACTGAGTATATTTAAAGGTAGGGTTAAGTTTGGGTTTAATACAAACTATAAGTTACCTTTAGAAATGCAATGTCGTTTGATCAATGGTTGGCTTT
GAACGACCTTGGTACCTTGTACCTAATATCCCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGGG
CTACGTACCCCGTTACATCCTCCCCCACATAGGTTCGGTTTACCGACCAATCAGAATGAAGAGGTGTTCGTCACAAACTCTCATTCTCAAAGTCGAAAAC
CATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGTCAAGGTCTATAATTCGACCGTT
ACCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCTGCCGGTAAGGCGCAAGCCAAGAGCACTAAGCCTCACGGCAAAGGCT
CGGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGTTCCTCGGATGACGCGGCTGTGGGCAAGCGAGCAAGCAAGCGCCGCAGTCCGTCGCC
CTCGTCCTCAGACAATCGTCCGAACCCTCGGTTCGTGGAACGTGAGTTCAACTCTGGCAGTGGGGACGAAGCCGCGTCTGAGAGCACGCATGATGCTCCT
GCGGGCACTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAGGATGACAGCGTGCAGTCGCTCGCTAGTGATCAAGGTGATCACAATCCTAGGACGT
CTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAGGAAGAGAATCCTCGCAAACGTCTCTCGCTTGCCGAGGG
TCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACAGCCTCTAAGTCTCCACTCCGCGAGGAGAAGGAGATTCAACAC
TCCTATCAGAGTATCTCCGACTCCTCGGGTGAAGAGGAGGAGAAGGAGGAAGAAGAGGAGGAGGGTGCCATTGTTGAGCCCCGGGAGGTCTCGAATGACC
TCGACCAGGAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGAGTTCGGTGGCGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTA
TTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAAAGATTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTATGAA
CGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGA
CTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACATGGAGTTCTTGTGAGGA
CATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGAT
CTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTA
TGTATTCATCATCCGTACCCCGTTCGGACAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCA
ATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCGTTCCCGCGAACACCGTTGCTCCTG
GGAGGATCCGCTCCCACGTGGAAAGTTGAACCTTCTCCCGTTCTGGTCAAGCAGGGGCGGAGGAGCCCCTCGTACGAAGACGAGTAATTCGGAGGCTTCC
GAGAACCAATCATCGTTTGAAGTGTTCCACATGACGAAGCCGAATAGATAACCTTGAGGATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCTTTGTGCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCG
TACGGTGCGTGCCCGGCGTACTTAGAGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGA