Description :
From Genome Similarity Track
Location :
Scaffold_2950:7- 2486
Transcript NameFunction/comments
Phyta_totarag14963hypothetical protein

Sequence
2479 bases(100 bases per row)
GGTTGAATGCGTTCGTGGTGTGTCCGTGGATGAACGCGATCGCACCGCCCACCGCACCGTAGTTACCAGGCGAACCGGACCAACCAAAGGCTGCAGACAT
GTCGATTACTAGAGCATTGTCCCGGGGAAGGCGGCCGCCGAAGAGGTAGACGCTGCGACTGTGTATGCACACGTGTCGGTAAGCATGCGCCACATCACCG
GCTTGTTCCTTAACGTCTCCGCTGGGATGATACGCTTGTTGGTGCACGATCTCGGCAATGGCATCGCAGTGATCATATTTCGGCTGGCATGCCGTGTCTT
TATCAGTGAAATGATTAAGCGACTTGTCCGCCGGGAACGAAAGATCGTGTATTACGCGGCCCATTGTTTGAGGATCCCTGCCACCCttgtcgacgacgct
gaaTGGACTAATGGCCATAAGGCGAGGATGTCCTCATCTGCGATGATGCAGCGCCATGCATCTTGCTCCGTCCGAATGTTTTTGATAACGACATTGTACC
TCTCGCTTGCCGACTGGTGGTTTGGCGGTCGCGTGGTCTGCTGTGGAAGCAGTTGCTTTAGTGGCACCCGTACCCCTGATTCCGCTACACCGACAATACC
AGGAAGGTGCTCGTAGCCCTGGCACGCAGTCTTCAACACGACAGGGATCATATTCTTGTTGGGCCTGAAATCGTCAGGGGTTTGACCGCGAAGAAGTTCC
GCGAAGGCCGGCAGCGATATTCGCGTGCGTCTGACGAATTCGGATAGAACAGCCTGAAGAGGCTTGCTGATACTATAAACCTCGTGGTGCATCATGGGGG
ATGACCTCGGAAGCTCGAGACCNCAACGGACGGGGCACGTCGAAACCGGGGCCGCTCTTCCTGGGTCGGGGTGCCGAGCTCACAGCGGGGGCGATGCGCC
CTGCACGTGCGCGGCTTGTGAGTACTGGTAGTGCGTGCGCTGGGGGCTGGCGTGGGCACAGAAGCCACTGTTTGCAGGCCAGAGGGCGCTGGGGTACGAG
TGCCGTGGGGCAACCGCATGTTGGGTGCGTTGCCGTGGGGCGAACGAACCAATGGCGACACAAACATGCCGGGGGGCGATGTAGTGCATGAGGCTCTTGN
CCGCGGCACCTCGGCAACCTCACTGGCGCGCATGGCGAGAGTCAGAACGGGAGTCCGAACGGGGATCCGAACGAGAGTCTGAACGGACGTCGCGGCGAGA
ATCCTCGCGGGAACCAGAGTCCTGATGGTAGTGACGGCCGATAAAGTCTTGTACGTGGCGCGATAGCCGACGGTCCCACACGTTGCGTGCACGTGGTATG
GGCACACCGATCCGCACTACCACCGTAGCACATGCCGCCGCTCATGAACCGCAAGCAGGGCTCGCGGAATCTGACGCCGAATATGATCGGGCATAACCGG
CACGCGACCGGGATGGACCCGGCGCGGTGCCGGTGGTGCGCTGCGTGCCGATGATGGGCGCGCGGGGCCCACGGACGCTGGCGTtcgagcagcgagacgg
AGCGCTAAGCCGTTGAGTGCAGCTTGCCAGTTAGCTGCGTGGTAATCAACAGCCCGCACCGCCTCGCAATAATTGCGCCACCAGTCGGGTGAGTCCTCCA
CGAGATGCGCCATTGCCCGGCCCAAAAAGTTGTTCACATAAAGGAGAGTCAATGTGACGCGTTCCTGAGTGTTCGTATCCCTCTCCATGTTTGCTAGTAC
GATGCGTTTGAGCCGGGACGTTAAACGCCGAACATGGTCGTAAAACAGCGTGTCGCCAAACGAAGTAAGACCGCTGATAGCTGCCAGCAAGTCTCCGTAT
GTCCCGCACTGCGGCATCGTCGCCGGCAGCATGGCACCAGCCCCAAAATCCAATGAGAAGTTGGCGTTCATCGATCCGCGCCTGAGTTGCTCCATTTCCG
TAAACGGCTTGAAGTGCAGGATAGTCAAGCCGCGGTTGCCGAGACGAGCGCTGTACAGAGCCATGAGaacaggggggggggcatcgAAGGGGACGCACTC
GAGCTCACGCAACTGCAGGACAAAGGACATGGGAGTAGTGTACGCACCTGCCGCAGTGCTCAGTGCTTTGTAGAGCCTGGGAGCCGCGAGTTGGTGTGTT
TGAGGCGGATGGTACTCGCCCTTTACGCGTGTCCGCGGCGGTGGAAAGCTAGTGCACCGCAGGTTCTGAATGGTGAGCGGAGGCATATCATCCGCGTTAC
CGTTCGGAGGGAGGGTCCAAACCGATGCCGCGAAACCAGACccgccgtgctggacggcatcgtGAGCCATGGCACCGGTGGTGTCCACGTCCAAACGGTT
TACCGTCGTAGCAGCGTGCGGTGGCGCCTGCATCTGCTCTCGGAGCTCGTGGATCATCGCGAAGAGCTGATCCACTTTGCTCTCCAAGGACGAGCCAGGA
GCCGCAGGTTGCGTGGACTGCGGGGCCGCCGCAGGCAGCGGGCGATGAAATTCCTCCATGAATTCGTCTAGGCTAAACG