Description :
From Genome Similarity Track
Location :
Scaffold_3767:7- 2122
Sequence
2115 bases(100 bases per row)
AACTCGTGATTCATCCTACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGTCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGA
TCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTCGTCCCTTTAGTAGATCCAAATCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGAC
AAGGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGA
GCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCATGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACTC
TAGTCAGCGCCTCATCCATCTTAGCTCTAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGT
CCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATG
GATCTTCCCACCAGCAGATTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGCAGTTCAGTTCATTCGGCTTCAGTG
TCCGGCTGACGAAGGTGACTGGATAGCAGATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTG
ACGTTCCGGATCGAAGTGACGGAAGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGT
TCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGACCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTAC
CACTTGGATCCCTTCGTGGATCCGGCATCTCCTAGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCT
CAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGT
GGGAAGGACAAATCGGTTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCCTGGAAACTCGATGGTCCAAGTACTCCACCTTGCGCATCCCCC
AATAGCGCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGAT
CAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGAAGTCCCAGGATCCCCTGGCTACCCCGCTTCGAATGGATCCATTTCCGTATTGCCTTCC
CCGGATCCACCCGTTTCGGGCTCCGGTCTTCGGGTGAACCCGTAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACG
GCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGAATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATGTC
AAGAGAACAGTACCAGAGTACTTTATCCAAATCCTCCAATAGCTCATTGATTAGAGGCATTGGATACACCATCAATCAGGTCAGGCCATTAACTAGCCGG
TAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGGCGTTGAGAAACTGATGATCTTGGCTTGCA
GCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCGCGCCCTTTGAGCGATCGGCTTCGCGTCGCCGACATTGATGTCATA
TTTGACCCCGCGGGCAGCAGGCGGTAATGCATTACCTTTACCAGTCAGCAGATGTCTGCTTTCCCAGATCTTCTGACGTATTCGATCCACTTCCGCGGGT
TCGTTCGCCCCTGGA