Description :
From Genome Similarity Track
Location :
Scaffold_1729:7- 2075
Sequence
2068 bases(100 bases per row)
CATGCGTATGCACAAACATATTTCGATGACATATTTGTCCATAGTCGGGCAGAACAGGGTAGGTCGGACGTGGATAACCACATCGACCATTTACGAGCGG
TGCTCGAGTGCATATGCACTAATAAGGTTTATGCTAATGCATCAAAATGTATCTTTGGTGCGGGTGAGATACCATTCTTGGGATGCTTCATCTGGAAGCG
AGGCCTTCGGGCAGATCCTGCAAAGGTGAAGGCCATATTGGATTGGCCATTTCCTAAGAATCAAACCCTACGCAAATGGCTTGGCATTGCCAATTACTTG
CACAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTGCTGGACTAGCACCGAACATGAGGCTC
TTAAGGCCGTAAAGGAGAGTGTCCTACATGCCCCAATTTTGGCTTTGCCAGATTGTGATCGGCCTTTCAGTGTCGCCTGTGACGCTTCGACCTTGTCATA
AGCTGTGCTCTGTTACAAACAGATGTTGAGGGACGCGAGCGTGTCATCGCATTTGAATCCCGTCAGCTCAAAGCTGCTGAAAATAACTATCCATTTCACG
ACAAGGAGCTATCTGCTATGAAGTATGCTATAGTCAAATTCATAGTTCATCTGCTTGGCTCTAAGCCTTTTGTTGTCTATACAGATCATGCATCATTGCA
CACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCTTTGGCTCTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCGGGAAAGCAA
AATAATTTGGCTGATGCGTTCTCACGCCGGCCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATACTTGCATCTTATG
CCAAGGATGAACAATGTGTCGCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAGAATCGGACATTAAATTGTCGGCACATTCGTGTGCGAGGCTACA
TCGATATTCTATCTACAGCGGCTTGTTGTGCTATCGCCCGAATACTGCGGATACCTCGCGTATTGTTGTTCCTCATCATGAAGAACTGAAGTAGTGTATC
CTCTATGAGGTCCACGAGACAGCTATTAGCGGTCATCTCGGTCGTGAGAATACCTACGGCTTGGTTAGCCAGAGTTATTGGTGGCCGAAACTCTATAAAT
GGGTTAGCACTTACGTGCGCACATTTGAGACGTGCTAACGGGTCAAACCCTCGGCACATGGGACTGTGCCGCTTGATAGTTTGTCTGTAGCCTCTGGGTG
TTGTGAGTCCATTAGCATGGACTTCGTGTTTGGCCTACCGAAGGATTCGGTGGCAACACAGGTATTGTAGTTTTTGTAGACCGTTTGAGCAAGATGGCTC
TTTTAGCAGCTGTGCCGGATTCGATTGATGATGAAGATACAGATTTGCTGTTCATTGATCGCATGTTTCGCCAACACGGACTGCCACTGGCAATTATCTC
TGACCGCGATCCTCGTTTACGGGCAAGTTTTGGAAGGCCATCTTCAAGGTGCTCGGTACCAGATTAGACATGTCTGCCGCGGATCATCCCCAGAACGATG
GTCAGACTGAGCGTGTCAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGAAGCTCCATGCTCCCCGTTTTTGAGTT
CGCTATGAACAATGCCGTCCATGCCTCGACAGGCTACTCCGTTATACGTGAACGGCCTCACACATCCCCGCGTTCCGTTAACGCTACCACTACGTGGCTC
AGGACTCGGTGGGGGAGAGGTGGTCGATCGGTCTGCTGATGTCAGCCCTGCTACTGTTCAAAAACAGGTTAGCGCGTTCCTAACAACGCGATTTAATGTC
TTACGACATGTGCGTGACGCAATGAGTGGTAGCCAAGACAAACAGAAGGAACTAGCGGATGCTAAAGGCATAATCTGTATTGAAAGTTATGAGGTCGATG
ACCAAGTCGTACTAAACGCTAATAACCTACCTACCAATGTAGTGTCTGCTGTGTTTAATACTAAGCTG