Description :
From Genome Similarity Track
Location :
Scaffold_604:7- 2010
Sequence
2003 bases(100 bases per row)
CGGTAGTATTTCTGGACTCGGTATCGCCATCGCCTTGGATCTTCTTGGTGCTACATACTGGAATGGACGCTTCTAGGGTGGATTTGGGATCCCACCCATG
TACCAAGTAAAATGGGGTATCACGCCGGATCCTGTCTTGGGCGATGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAA
TCCTGGAAATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCTCT
GCCCCAGGATCCGGTTGAAAGCTCAAAAGAAATCAGACATAAAGCCTGGCTCCCGGTCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCA
CTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCAAACAGATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAA
TGACTTGGGCAACGAGGGGATATGATCCATGGATATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCC
TTGCCTGTCTCACAATCCACACATTCGCCGACATATCGTTGTACGCTCTTGAATAGTCTTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGAC
CAATACCCTGATGTCCACCTTCTAAACTAGCGTGACAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCTCGATC
CTCGTTGATTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATACTGTAGGATTTGGCATCCTCCCGA
CTCAGGTCTCGTACGTCCCCCATCAGATACTTCTTTAGTCCCAAAATCCACGCTTCCTCGTCCTGTGCTTTGAGGATCCGCTCAATGCGGACTCCCTTCA
CAAATGTTTCCTCGAGAATCTGGGGGCTGGATCCAACCCTTCCTCTGGACCTAGTGACAGCCACCACCTGGACTGCCCTTTTCCCGGATCCAACTACCAC
CACTTCATCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGACACCACATTTATTCCGTAAAGCGGCACTGGCCAAGCTA
TCTGCGCTGGCATTCCAATCTCGCTTAACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACTAAGTTTGAATCCCCACAAATCACCAGCCTTTTCGGATCCTGTCCCTGTAGTAGATCCAA
ACCTAGCAGGAGCCCGCTATACTCCGCTTCATTGACGGCGAGGCCTTCCGCGTAAGTGGATCTGGTCCGTACAACTTCCCATCCGGGCAGTCTCCACAGT
ATTGCGCTGTATGCTCCTCCTCCGCGTCGCACGCGAGTGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACCTGTACCGTTGGGATCGGGATCT
GGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATTCTAGTCAGCGCGTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTC
GTCTTCCCCTTTCGAACATTTCACAATTTCCAGTGTCCAAGGCGAGAGTAATGCTGCCCTCTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGC
CAGACTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAGTACGCGCAGAAGCGCAAGTATCTCTTTCT
CCACCGCTCCGTAGCTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAAGCTGCTGAGAC
TGC