Description :
From Genome Similarity Track
Location :
Scaffold_89:7- 1995
Sequence
1988 bases(100 bases per row)
ACTTCCCCTCACCAGCTCTCGACTTCTGTGTGCGCAGACACAGGAGGATGGCGGATAGTGGACGTATCACAAGTAAATGATGCACGGTACCGGCTCAAAC
GCCGATACCGAGGAAGGACTTAATCATTGATGGTATGTCAAGGAGTACCATCTTCTCGTCCATGGATCTGATGGATGGCTTTTATCAGATCCTAATGCGT
GAGCGGGACATCCCGTACACGGCAGTAAGCACCCCTAGCGGCATGCTTTGGAAGTGGCTAGTAATGCCACAAGGGCTGAGTAACGACCCTGCCACCTTCA
ACAAATGCGTCACAAATCTGTTGAGACCGGTGCGAGACTTCGCACCGAGTTACTTCGACGATGTATTCGTCCATAGCCGGGCTATGAGCGGAAGGACGGA
CGTAGAGGTTCATAGAACTCACGTTCTTCAGGTTCTTACAAGCATAAGCTTTACGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACTTC
TTGGGTGTATCATGGGTAAACATGGCTTACGCCCTGATCCTGAAAATGTCAAGGCGATTACCGACTGGCCTGTGCCAGTCGACGTTAGGGACTAAAACGT
TCCTTGGTCTAGAGGCGTACTTACACAAGTACTCGCGCAACTACACAGAGATGACCGTTCACCTCTGTCGTCTTTTGAAAAAGAACGAGAAGTGGTCATG
GGACACTGATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGATTGATGCAATCGCCCATCTTGGCGATTGCATACCAAAACAGACCATTCCATGTGGTC
TGTGACGCCAGAGATTTCGCAATCAGCTGCGCGTTAATGCAGTACGATGCAGACAGCGCACGCGTCAGCTGCAAGCAGCTGAGCGTAATTATCCAGTGCA
TGACAAGGAACCCCTTGCCATGAAGTATGCACTAGCAAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCGTTTGTAGTCTATACGGACCATGCGTCATTA
CGCACGGCCGTAAACAGCCCACACCTCTCGCAAAGGATGGCGAGGTGGCTGTACTTCTTTGTGGAGTACAACTTCTCCGTGGAGTACAAACCCGGACGAC
TCAATGTCCTTGCGGACGCGTTGTCGCGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAAGAGTGAGGTTGATACCACTGTTGCGACACTATTCACTAG
TGTTCCGTCGTCAACATTTCTTGACGATATAAAAAGGCCTACGCAGAAGATAAGGCTCTTCTGAGACTAAATGGATCATCTGGTGACTCCATCTCGTAAA
TCTCTCAAAGATTTACCGGCCTTGTATCGATCTCCCGCAGATCGATACACAACACGCAACGGGGTTGCTGTATTATACAGCCGTTACCGGCGATACACCT
CGTGTCGTCGTCCCCACTCATAATGATTTGATCTTTCGCATCATGTAGGAGTACCACGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATC
TCGCGGTAAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGCGCAAGTACATTCGTGCTTTTTGAAGTGTGCCAACGGGTGAAGCCTATTCCTT
CACCCCGTGCGCCATCACAGCCTTTACCAATCCCGGCTGGTTTCTGGTAGTCCGTTTCAATGGACTTCGTCTTCAGTTTCCTCGCTCACAAGAATAATGG
TATTCTTGCGTTCGTAGACCGATTCAGCAATATAATACATCTTGCTGCTGTTAATGAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACG
GTATTCCGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAGATCCTTGGTTCACGGCGACGTTTTGGCAATCCGTTCTGATCCCTCGGAACACGT
CTGAATATGTCTACTTCTGACCATCCAGAGACTGATGGTCAAACAGAACGCATCAACCGCGTCCTCGAAGAGATACTTCGAGGATACG