Description :
From Genome Similarity Track
Location :
Scaffold_996:7- 1979
Transcript NameFunction/comments
g16751.t1hypothetical protein

Sequence
1972 bases(100 bases per row)
TCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAAGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCC
GCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGC
GTTTTGTTGATCGGACCCAAGGGCCTCCACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATG
GCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTAT
CACCACCTCGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCGAACTCAGAGAGTAGTCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTT
AAGCAGTGCATCCTGAAGCCCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGG
TCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCTCTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACA
TCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGTAGAAGAGGGTACTGAAGCGGATC
ATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGATTGCCGTCCTCGATGAGCGTC
GCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCG
AGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCGCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGC
AAAGATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCA
ATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACACCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGT
CCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAG
TTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCTCCAGGCCACTTCCAAGCGCCA
CAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACG
CCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTC
TTGGTTTACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTAAGCTGTGATCTGCGCTCCACGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGC
TCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTGGTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTGGGCAT
GTTGCTCCTGGTTTACTATCCGTTCCTCGGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCCGGGCATGTT