Description :
From Genome Similarity Track
Location :
Scaffold_1575:7- 1965
Sequence
1958 bases(100 bases per row)
CCGTGGAGACGGAAGACATGGTCGATGAACAGTCGAGCGCAGTCTTCACCTGTGCAGGTATCCGATACCGGAGCGAGATGAACCATCTTAGAAAGACGGT
CAACGAAGATCAATACACCATTGTGTCCTGCCGACGTCTTCGGCAACCCAAAGAAGAAGTCCAGACTGACGGACCGCCAACAATCACTTGGCACAGGCAA
ACTCTGCAATGGGGCCTGTGAATGTGAGCTTGGCTTCACACGCTGACAAACGTCACAGGTACGAACGTACGGTGAAACCCACTTGTACATCTTGGGCCAC
CAGCCCCTGGCGCTGAGAAGGGCATAAGTCTTATCACGACCAAGGTGACCGGCCCCTGGGGCGTCGTGTATCCCATAGGCTATAACAAATCACAGGTCCT
CGTCATCAGGAACGACGACCCTGGCGTCCTCGCCGGCTGAGACTTGGTACATCAGCAAGCCATCTTCGAAGGAATGGCGGTGGAGTCGACCTCGTACACA
AGGACTGAGAGCCTTCTCCAACGACGCGTCATTCAACGCCCGAATGATGGCTGCACAAGCTGCATCGCGTTCGTACGCGTCACGAATCAGCTCGTAGACA
TCGGACGTGAGCGATGTGAGATGGTTGATCTCATAGTCGGGACGCCGAGAGAGGGCGTCGGCTAGCACGTTGAGCCGACCCGGTTTATATTCAACCGTGA
AGTTGTAACCTGAAAAGAATGACAACcACCTTGCCATTCGAGGCGAAAGGTGTGGCGATTGAGTCGCGGCCCGCAAGGATGCGTGATCGGTGTACACCAC
GAACGGGAGAGATTCAAGTAGGTGAACACGAAACTTCACCGGCGCATATTTCATCGCCAACAACtCCTTGTCATGAACTGGATAGTTCTTCTCCGCTGCT
TGGAgCTGCCGTGACTGGTAGGAGACGACTCTCTCGTGACCCTCACTGTCCTTCTGCAGCAATGCACAACCGATAGCATAGTCGGATGCGTCATACACAA
CGCTGTACGGCTTGGAGTCGTCAGGCAGAGCCAATACCGGAGCCTGAAGGAGGCTCTCCTTGATACGCTGAAATGCAGCTTCGGTCTCTGGTGACCAGGA
CCACTCAACATCGTTCTTGAGAAGCTGGGTCAGCGACCGAGCCATCTCAGCGTAGTTCTTCGTGAACCGATGCAGATAGTTGGCATGACCCAACCACTTG
CGCAAGTCCTTCACCGACTTTGGCGATGACCACTCGGCGATCGCCTTGACCTTCTCAGGGTCAGGATGAACTCCTTCAACCCCGACGAAACACCCTAGCA
CGGGGATTTCGTCTGCACCAAAGATGCACTTGTCCAAGTTGGCGTAGAGCTTGTGCTCTTCGAGACACTCTAAAACTTGACGAAGGTGgTCCTCATGGAG
CGAATCCAAGTCACGACCAGGCTCTGGCTTCGTGTGGACGTAAATATTGTCAAAGTACGTCTGTGCGAAGGCTCGCAAAGGCCGGAAAAGGTGTGTCACC
AAGCGATTGAACGTCGTGGGAGCATTGGACAACCCTTGTGGCATCACGAGCCACTCCCACAGCATGCCACTGGGGGTGCTGACCGCAGTCCTGGGGATAT
CCAACTGCTCCATGAGCACTTGGTAATAACCATCGACCAAGTCATGGGAGCTCAaTCGCTTCGCACCGGACATTCGGTGGATGATGACATCCTTCCGAGG
AATCGGACTCGACGCTGGGACCGTCTGAGCATTCAGCTTGTTGTATGCGTGGGCGATCCTCCATTTGCCATTTGGCTTCCGCACACAGAACGTGGGTGCG
CTGTGAGGAGAAACACTCTCACGCACAAGTCCGGCCTTGTGCTTCTTGGCGAAGAACTCGTTGATGAAGTCGGACTGTTCCGCTGGAAGCGCCCACTGAC
GCACCGTCGCATAGGTCGACCCTGGCTTGAGCTTGATCTCATGTCGAATGCCTTGGCC