Description :
From Genome Similarity Track
Location :
Scaffold_849:7- 1930
Sequence
1923 bases(100 bases per row)
TAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGATCGTTGGCTTATGGTCGGTAACTCAGCGTAGCTCTTGATCTCGACTGCATCA
TCTCGGAGAATTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGCGCCCCGAACTGCCTGAAGACGCATTCTTCAAA
TACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTAGAGTGGTCCTGGAACAGCAGCAGTGCAGTATTGCCCCGC
TGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGTAACCTCTCAACTGTGGCTTGC
TCTTACTGGAATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTACAGACCAATCCAGTAGTAGTCGGTCTTGACTCGGTGATAAGTTCT
GACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATCTCGTCGACCATAGTTGACGGAATCACCAATCTCAATGAGAGGTTCGGT
TCGCCGAGTTCGCCCAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAGATACTTCTGCGACTTTGCCGGCATTCTGAGCTC
GACGGTGTGTAAGGTCCTCAAATTCACCTCTCAGGCACGCCTTCAGGTCGGCCCACCTGAGTTCTTCATCTTGTGCCTTCGCGATTCGTCGCCTCCGCTC
AGTCTGTACTGTCACTGGATCGATGTCGTTGGCATTCTGAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGACATTCGGGGTCGTGTGGTTAGTC
CGCCGAGTCGATGCCCTGCTGACTTGTTCGAATTTATCTCCACTGCTTTCAAGCGCAGATTCTCTTGGATTTGTTGACACGGCTTCGTGATCCTGACTTC
CTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGG
GTTGTCTGTGGCGTACAGTTCTTCGGCTACTCGGTAAATCATTCTCAGCTCTGCTTTCCTATCCGTCCCGAGAATTACTCGTCCAGCTTTAGCTTCCAGT
GCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGCTTCGTGAGATCCTTGTGTCGAGCTA
GCTCCACTTGCAACGTTTCCTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCG
GTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACTCGCAGCAATCATAATGTCCCAA
TTCGGCGAACAACTGCCATACGACCCCGCGTCAGGACCATTCTCTTATTTCTGAAAAAGCACTTCACCACAGACGCTACATATATTGCTGGAAAGTTCGC
ACAATATCTGAAGGTCGCACACTACGCGCGCAAATACAAAGGAAGATGACACTTTTTCCCGGAGGCAGTGTGGGGTGCAGGGGTGTAAGCCACAATATTA
TTTTTTAGTTTTCACATTATTGATAGTAGCAATAAAATTGTGATTTACTATCTAACGCTAATATTATAATTATATGGACTACTACTACAAATAGCTGCAA
GCAAAAATATGAAATGTCTTGATAATAGTACTACGCAAAACAGTTTTGTAAGATTAATTATTAGAAAAGTACTACGAAGCCTAAAATATCATTCTAAAAC
TAATAAGTACTAAAGCTTCGATT