Description :
From Genome Similarity Track
Location :
Scaffold_3261:7- 1899
Transcript NameFunction/comments
Phyta_totarag15180reverse transcriptase

Sequence
1892 bases(100 bases per row)
TGAAGAATAAAATCGCTACAGCACCCATCCTACAACACTTCGACCCAGATCGACGACCAGTGATCATAGTCTACGCGAGTAAGTGGGCGATCTCGGCAGC
TTTGATGCTGGAGCATGACGGGACGTACAAGCCGGTGGCATTCACCAGTCGCCCATTGAAACCTAACGAGATCAATTACGGCATTGTGGACAAAGaagtg
ctggcgctgctcggGATGCTGGATTTCTGTCACACCCAACTGGTGACCCGACCAATCAAGGTGTTAACTCGGCATTCCACATTGGCCTGACTGGTTCACT
CATCGGGCTTGCGGAGACGCTTGGACAGGCGGGCCGCACTTCTTTCTAGCTGGACGTTGGAAATCGTCAAATGTACGAAGGGCAAGGATGAACCTTGGGT
GTGATAGCGGCAAGCATCACTCCccgagaagaagttgacgcgATCTTGACGTCGATCGCACCGCGAAAGGAACCTCGTCAAGTGATCTCGATGCCCTCTC
CCACGGTGGAGCCCGAAGAAACGCTGCTTGTAGCAAGTTTCGACGGATCGGCACGTGCGAAGCGAGGTGGGGGAGCGTATGGAGCGATTGTGTGGAGTCT
AACAGAATGAACAGTGATCTCGGCCGCGTCTGAGTACAAGGTCGATCTTACCGTAAATGAGGCGGTGTATCATGGTTTGCTCCTATGTTTCGATCTCCTG
TCCAACTTGGACAGGGGACGGCTGATTATATGTGGAGATTCAAATTTGGTGATTCGACAAATGCGCGGCGAAATCGAGTGTAAAGCCCCAGGGCTAAAAT
TGTTGCGTGAAAGAGCGATGGAACGTATGCGATCGTGGCCGCACCACGAGTTCCTCCACATGAAGAGATACCGGAGCCAAAGTGCCGACCGACTAGCCGG
CGCGGCGCTCCAACGTGAAGGGGGTGACGTGGTTACGACTGAGATCGAGCGCCAAGATTTGAGGACGCTAAATCGActgagcgagttgctggttCCACAA
ACGAGGAATTCTACTGTGAAGATCTCGGCTGTAACCAGATCACGCAAGCGACGCAGTCCGGAAGTCCTGAATGAGGAgatcgtccagcagctgagGGCTG
AACGTATTCTTCGAGCGCAGAACGAAGAAAAATGGATTGGCGATCTCAAGAAGTACATGCAAGGGGACGTACAAGATCTCAGCTCGGCAGAAGCAAAAAC
CTGCGCCAAGATCGCGGAAGACTATGAGATCAATGAAGAGGGGTTGCTTTTCTACTGCCCGCCATCAACGCAGTCGCGTGAAGGTCGTGATCTTATCGTT
CGATTGGTAGTCCCGGACACCCTGCAGGAGGAATTCCTGCATCATTACCATGTCAGTTTGGAAGGAGGACATCAAGGAGTCGGACGGACTTACCAGCGAC
TGCGAGCACATTTTCACTGGAGAGGAATCTATCAGAGCGTGCAGCAATATGTGAGGCGGTGTGTGGATTGTGAGACGGGGAGGGGAAGACCTGTTATCCG
AGGCGAATCACCGGGTAATTTACAGGCGACCTACCCGTTTCAGATCATTGCAATGGATCACATCCCATCGTTACCTCGATCTCATAAGAGCAACACCGAG
TTGTTGATCTGGGTCGACCTCTTCACCGGATTTGTGATCGCCAAAGCTAGCGCCTCCAGGACGGCACATACAGTTGCGGAGAACTATGAAGAGTGCGTTT
TCCGGTGTTTCGGTGCGAGTGAAGCAATCCGCCATGATCGAGAACCCGGGTTTATGTCGGACTTCATTAGATCGTTCAATAAGATTGTCGGCCAAAAACG
GCGCGCAACGATGGCGTACCGCCCACAAGCCAACGGAACAGCCGAGCGGATGGTGCAGACACTAACTCGGGCGTTAACGATATACGTCGCAG