Description :
From Genome Similarity Track
Location :
Scaffold_835:7- 1844
Sequence
1837 bases(100 bases per row)
GATCCAAAACCATCAGTGTTGGGTTGAAGATCTTATATTGATGACATATTAATACCAGCTACGTCGTGGAATGCCCTGTATGAGAAAGTGGAGAGATTAT
TGGAGGTGTGCGATAAGTGGAATTTGTCGATCAGTTTGGCCAAAGGGTTTTTGGAGACGTCGCAAGGTGGAATACCTGGGACATCAAATCTCGCTCGCAG
GTTTGGAAGATAATCCGAAATATCTGGGATCGTTGGTGAACATCCCGTTCCCTCGGACGCTGCGAGCGATGCAGTCATTTTCGAGAAGTCTCAACTATTA
CAGTAGATTCATTAAAGACTTCGCAGTTTACGCATCAGTGTTGTACGAACTGCGTGAAGCAGAGTTCCATGAGATCAACCGCGTGAGTGATGCTTCAAAA
CCTACCTCTGCTGTAAGACCTGATGCTATCCACGAAGGGAGTGCAGGGGGCGATCGTGATCTGGTGTACCCAAAACCGGAGATCAATGTCGTTCGGTACC
CAATTGCAGGGGACGATCGCGATCCCGAGGGCAGGAATCGATGGGAGAAGGCAATGATTGCATTCACGTTGCTAAAGGCTAAGATAGCCATAACTCCAAT
CTTAAAGCATTTCGATCTCGATCGATCGCCTGTGATCGTGGTGTATGCTAGTAAGTGGGCTGTATCAGCTGCTTTGCTTCAAGAATATGATGTTGTGTAT
CGGCCTGTCACTTTCTCCAGTCGTACGATAAAGCCCAACGAGGTCAACTACGGGATGGTGGAGAAAGAAGTGTTGGATCTCCTCCGGATGCTAGATATCT
GTTATACTATGCTAGTATCCCGTGAGATTACGGTGCTTACGCGATATTCGACACTAGCATCGTTACTACCATCTTCAGGCCTAAACGGAACATTGGGAAG
ATGGGCTGCTTTACTACCGACTGGACGTTGGAAATTAGGCGATCTGAGAAGGGAGAAGATGAAATACTCGGCATGCTTGCGGCAAGTATAACACCTCGTG
AAGAAGTAGATGAAGTATTGATTGCGATGGCCCCGCGGAAGCAGCCAAGACAGGCGATAAGCATGCCACCACCCACAGTAGGTGTGAATGAAAACCTGCT
GGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGAAAGGGCGGAGCATACAGCGCGATTATATGGAAACTGCCGGAATAGACGATTGTGGCTGCTGCT
TCCGAGTATACCCCTGATCTAACCGTGAATGAAGCAGAATACCGAGGGCTGCTCCTTAGTTTTGATTTGCTTGCCGATCAGGCAAGGGGACGGGTAATTA
TCTGCGGAGATTCGAATTTGGTGATCCGTCAAATGCGAAGAGAAATCGACTGTAAAGCGCCGGGACTGCAGTTGTTGAGGCATAGGGCTATGGAGAGATT
ACAATCGTGGCCATCCCAAGAGTTCTTGCACTTGAAGCGGGACTGGAATCAGAGTGCAGATCGATTGGCGAGTGAAGCTCTACGGCAAGAGAAAGGGACA
GTTGTGGTTTCCGATCAAGAGCGTCAGGACCTGATTACTCTCAATCGGTTGAACGAATTACTACTACCAGAACGAGTTGATCGTGCGGTCAAATCAGCGG
CTATCACTCGAACAGCCCAGAGAAGACGATGTCAGCCCAGGATTTTACAGGAAGAGGTTGTGCAGCAGAAACGGATTGGTCGTATTAAGCAAGCACAAGG
CGAAGAAAACTGGACATCTAGTTTGGAGATATATCTGGTTGGAGACGTAGCTAATTTATCGGCAGCTGAGCTAAGTGTGCACCCTGATCGCACCGGACTA
TGGAGTAGACCAACGTAGGCTGCTATTCTTCTGTCCA