Description :
From Genome Similarity Track
Location :
Scaffold_1257:7- 1738
Sequence
1731 bases(100 bases per row)
ATGATCATGAGCGGGTCATCTCGTATCAGTCGAGACAattgaagccagcagagcgAAACTACCCAGTTCACGACAAGGAGCTACTTGCGATGAAGTACGC
TCTTGTCAAGTTTCGAGttcaccttcttggtgaacagCGCTTCGTGATCTATACAGATCACGCATCACTGCGTACTGCAGTGAAGACCCCTCATCTATCC
CAAAGAATGGCAAGGTGGATATCCTTCTTTGCGGAGTACAACTTTGTTGTACATTATAAACCTGGCAGAATGAATATTCTGGCCGATGCGCTCTCGAGAC
GTCCAGATTATGACACTCGATCGAGTGAAGACGCATCATCAGACGTTTGCAGAAGTTGTCCAAGTAACCAAGACACTGTGAACGCTATCATGGTCCGAGC
AAGCTCGTCCATTCAAGAAGACATCAAGCGAGTGTAcaaagaagatgaaggtTGCAGGGAGATGCTGCATTACCTTGAGGATCCGAGCAATGAGAAGTTG
ATAATGCTATCAGCAAaagcaagatcaaggatTCACCGATATTCTGTCCACGAAGGGCTACTTCGGTATGGGGTTGATGACGGAGAAATGCCAAGGATTG
TTGTTCCCAACAACGAAGAGATTCGGCACCGTCTACTGTTTGACTATCACGACAGTCCCCCAGGAGGTCATCTCGGACGAGAGAAGACTTTATTGAGTCT
CTCTCGAGACTATTATTGACCTCATATGTACAAATGGGTGCGCAAGTACGTCTGTACTTGTGAGGTGTGTCAGCTTGTGAAGCCTTCGAGTTCAACTCAG
GCTCCACTTCGGTCACTACCTGTCCCAATTGACAGTTGGAAGTCTGTGAGCATGGACTTTGTGTTCGGACTTCCTACTGACTCGCAAAATCGAAACGGCA
TTCTTGTAATCGTGGATCGATTTAGCAAGATGGTTAATTTAATTGCCGTTCCGGAAACCATCGATGCGGAAATGACAGCACAAATGTTTGTGGATACTGT
CTTCCGGCTTCATGGTTTGCCTGACGAGATTGTCTCTGATCGAGACACTCGATTTACCTCCATTGTTTGGCGTACAGTATTCGAGCGCCTAGGGACCAAG
TTGTCGATGTCGACAGCTGCACATTCCGAAACTGATGGGCAAACGGAGCGTGTGAATCGTGTGCTAGAGGACATATTGCGGAGTTACGCAACATCCTTTA
AGGAATGGAGTGATTTTCTCCCTTTGGTTGAGTTTTCAATCAATAACTCAACACACGCTTCTACGGGCTACTCTCCGTTTTACATCAACTGTGGATTTCA
TCCTCGTGTTCCAGCAACACTTTCGGGGGTAGGTCCTACTTTTGGTGGGGGAGGAACTCCTGTTGAAACAGAGTTAAATGCAGCGAGTGGGTCAGATATA
CGCGCTAATTTCGACGCTCTGGTTCCTAAGACCAGAATGTCAACGCGTGACCAAGTGAAAATCGACGGCTTTGTTGACAAACGACAAGCCATCGTAAGAT
TTGTGCGCGATGCAATCGCTGAAGCACAAGATCGGCAGAAGGAGCAATCAGACAAGCATGGGCGAAAGAATTTATTCAAATTCAAGGTTGGTGATCTTGT
ATTACTTAATGCAACTCACCTACCGGAACATGTAGTGTCCAACTTTGGAAGTAGGAAACTACTCCCTAGGTTTATTGGACCATTTAAAGTTCTGAAACGC
AATGGAGATGTCTATACTATAGACATTCCTA