Description :
From Genome Similarity Track
Location :
Scaffold_2033:7- 1728
Transcript NameFunction/comments
Phyta_totarag14026Crinkler (CRN) family protein

Sequence
1721 bases(100 bases per row)
TCCGTCAGTGGTACGATCCGACCAAACATGCTGGCATGCTTCCGGCCAGGGCCGAGAAGATGTTAAACTAGGACGCTCGTCAGGTTGGAATCTGATACGA
GCCGAGCGTTCGGAGGTTTGCATTGGTAAATATAGCAGATCCGACGTGGTGATGTCtctggatctcctcgcgGGAGAGTCGCGAGGTTACTGGAAGCATC
ACGCGCCGAGTCAGACAAACGAAAATAACGGGAAGATCAACAATGAAAAGGCGATCTTACTCCTAGATACCGGTGCCGAGGTGTCCATATTGGATACCGC
CTTTGCTCGTAAGGTTGGGTGCTATGTCGACACGAGTCAGAGCCAAGATTGTGTGGGAATTGGTGAAAGTACATATACGAAGAATGGCAAGACCCGAGTC
AAGATCACACTAGCAGGATCTCTGGTTTATTTCTGCGATATCTGGCAGGCCAAGATGCTACCTTAGGCATGGATTTCATGGTACCGGCTAGGATCCGGCT
GGATCTAGCCGATGGGTCGATCTGCTTGCCGGACGAAGTGAAGATCCAGTTtagtggacgacgacagctccacaATGACAAAGCGAGGTTCTTGAGGCTA
GATCAACATACGCTGATCGGCATCGGAGAATCCGCGGAGCTACCAAGGAGCCTCAACTATTCTTTCGATCAAGAAAAATTGTGGATTACTCGGGAGGTCG
GTGGGTGCCCACGGTGGTCAGTGGCCCCGGCAAGTCAAGATATCTGCAGATCACCAGCATCGGCGACAGGAAACTGACCCTTCAAGGTGACGAGCGAATC
GGGATGTGGCTGGCAGGAGATCGTGTGCCACGCGTCCCAGGATTCGTCTCTGTTGGATCGCGCCGCTATAGGGACTGGCAAAATCTAGCCTTAGAGGCTA
CCACAGAGACGAGATCGGAGGAATGCCAAACGGTCGACGTCGTTGATAGCCCTAGTGTGCATCGCCAGGAGTACCCGACACGCTTGCGCGATATTACGGA
GAAGTGACACTACGCCGATCCAACGCACATCGATCGGGTTGTTGAGAACCGAGCCTAGATCGGACACTACGTTGGGCGACCAGGCTTTGTCTGGAGAGGT
GACGCTGGCGTTGTCCGGAAGCATCCCGGCGCGAGTGGACGAGCTTTCGGGGCAGACGGATCAGGCAATATCAGGGGTGTCAAAGCCAGATCCAGATGAT
AATAAGCCATCGAGATCAGATGTGGTGCTGACACACGGGGATACATCGAGCGAAGTGGGTCATCGATCGCCTACCGTAAGGATGGCGAAGTTGCTCCCGA
AAGACGTGCCAGCGACAGACCCGGAACCCAGGCTGATGCCGACAAACCACTCGAAACAAGTTGATCTAGATCGACGAAAATAGGAAGATCAGGTTGAGGA
GGAGCAAGTCTGTTACCACGAAAGCGGAGATCTGCACGCCGAGGAAGTTCAAGGAGAGATGGCAGTTCTCCCAGAAGTCACCCTGAATACGAATGAAGTT
ACGATCGACGATATCCAAGTAGGAGATCCGGCGTTCAACTCTCTGGAAGAGGTCGATTGCTTACGTCGGAAGATCTGGAGGTATCGATATCTGCTCATCG
GCAAGGGTAATGCGTTACCGCCCGCTGCCAGAGGCGTTGTATGCGACATCGATGTGGGAAACGCTACGCCGATCGCTCAACGCGTGAGGAAGGTGGCCCC
ACAGTTCCGGGAAAAGTTGTC