Description :
From Genome Similarity Track
Location :
Scaffold_156:7- 1679
Transcript NameFunction/comments
Phyra_85231Hypothetical protein

Sequence
1672 bases(100 bases per row)
CAACGGCGCCGCCACCTTCAACGTCGCCGCGGCGTCCGCGGGCTCGTCGGCCGGAGCTACCAGCACTACAGTCGGCTCCAGCACGTCCACGCCCTGGTGC
GACGACAAGAACTGCCCGGGTATCGTCGGCGGCATCGCCTTCGCTGTCATGGCCGTGTGCGGCCTGCTGCTCACGGCGGCGCTCAAGACCTCGCCCGTCG
GCAAGCTGCTACTGCACCGCACGGTGGCCCCGCCCCCGGTGAAGCTCACGACCAACGCACCTGTAGCCAAGCCCCATACGATGTTCATGCAGACGCTGGC
GGACCTCCATCTCGGAGAGCTGCTGGTTATGCTCATCTTCGTCGCTGCGGTGGTCGTGCTCATCGCGCTGCTGAGCGACGAGGACAACTACGTGGTGTCG
GGCCAGGTGAGCCTGCTTATCCTCATGTTCCTCATTCTGCCCGTGTCGCGCCTGCCCGTGTGGTCGGTGCTCTTCGGCAGCTCCTTCGAGCGCATCGTCA
AGTTCCACCGCTGGCTGGGTGTCATCATGAACGTCGCGGTGATTGTCCACGTCGTGCAGGCCAGCAAGGTTGTCGACCTCACGCTCAACGAGAAGTACCG
CGACGTGACCCCTCTGCCGGGTTTCATCGCCTTCATCTGCTTCATCGTGATGATGTTCATGTCGATTGAGTACATCCGTCGCATGTTCTTCGAGGTCTTC
TACTTCACGCACCGCGTGCTGTCGATTGTCGGCTTCGTGTTCACCATCCTGCACGCCCCCAAATTCATCGGCCTGGCGCTGTGTGTCCCGCTTGGATTGT
ACGCTCTTGGTCTGCTGTACCGTTGGTCTAGCGCCTTCACGGGCTCGTACAAGACCTCTGCTTCGGTGCACTCCGGATCGAACTCCACCGCGCTCGTCCT
CGAGCCGACTCCGAAGACTGGCAAGATGGCGATGAACGTGAACCCTGGCTCGTACTTCCTGGTGCGCCTGCCGGCTATCTCCGCAACCCAGTGGCACCCG
TTCTCGTCCATCGTAACCCCGGACGGCAAGTCGCTTGGTTTCTGCATCAAGGCTATGGGCAACGGCTCCTTCACGCGCAAGCTTATGGAGAAGGCCGGCA
CGCAATACGAGCTCACAGCTAACCTGTGTGGCCCCTTCGGTAAGATGTCGCTCAACGTGGATCGCTATGATGCGGTGGTGCTTGTCGCCGGTGGTGTGGG
CATCACCCCGATGATGAGCCTCATCAACCAGACACGCTTGTTCCCGAATGCCGCCAGCGACTCGGACAAGACCCCCAAGGCAGCGGACTGGTACGTGATA
TGGTCTGTTCGCGAACCGGAGGACATCCTGATGATGGAGCAGTTCCTGCCGACGCACGCTCAGCTCGACTACGCCGCTCGTGCCAGCATCCAGGACCCCA
ACATGGCCATTCTTGGCAACAACGCGCCGGCACCTGTCAACATCAACTGGATGTTCCACGTCTCGAATGCTCGTAGTGACGGCGTGGTTACCCGTGCCAA
CGGCGAGACGTTGTCCTACCGCGGTGGCCAGCCGGTTCTTGACGAGGTGATCAACACAAGTCGCTTCAACGGCCGCAAGGTGACTGTGGTGGCCTGCGGG
CCGCCCACCATGACCGTGGAGGCTCAGTCGCTCGCGCGCAACTGCAACTTCGACTTCCACAAAGAGGTCTTC