Description :
From Genome Similarity Track
Location :
Scaffold_154:7- 1643
Transcript NameFunction/comments
Phyra_85217patatin-like phospholipase, putative

Sequence
1636 bases(100 bases per row)
AGTGGCCCGCCGGTTTTTTTCGGGCGCGAACATTTCTGCTAGACACGCTGAAGGCCGAGGGTAAACTGCACGAGTACAAGAAGCTCAACGCGTCGCAGCA
GGTCACAGTCGTGTACACGTCGCTATCGGCTTTGAAGTCGCGGCGGCTGACGGCCTTCGAGTCGCAGCGGCACCTGACCGACAGCTTGATGGCCTCGTGC
TGTGCCACGCCCATTGCCGGGATGCCCTTCCGGCTTGGAGGCGAGTGGGTCATGGACGGCGGCATCTTGGACTTTCAGCCGATTTACGACGACAAGACCG
TGACAGTCAGTCCGTTCTACTGCACGGGCGCGGACATTAAGCCGTCGGTGTACGTGCCGATGTGGTGGGCGATGATTCCTCCGGGAGTGAGGGATGTCGA
GTGGCTCTTTGATCTGGGCTACGAAGACGGACTCAAGTGGATCGTCAAGAACGGACTTACGGGCAAGCGCAAAAATGTGGTGATCCCCACCAAGAGCGCA
GAGTACGTGGGCGAATGGAGCACGACGGTTGGCCGTGTGGTTGGGTACCGCGGCTTCGAGAGCCGAGTGCTGGACGCCCTCTTCGTCGGGTTGTTCGTGT
GCCTCTGGCGACCGATGGCTTTCCTGTGTCTGTATCTGGAGCTGTACTTGCAAGCCGTTGTTTCCGGCAGTAAGGCTGTGGTCTTCGGAGCCGCGGCCAA
GCTGCTGATCTCGAACATTATCATGGCTGCTTTTGCCGTGGTGCTCGCAACGCAAGGATTCCAGCACACGATGCTTTTCTTTTTGGGCCTTACTACGGCT
GGATTCTTCCTTGGGGGCGTGGTCCTGCTTGTTGGCGGTATTCATGAAGCTGCGGCAGTCGCTTCTCAAGATTGGCAGCGCTGTCGCTCGTATATGCGCA
GCATCACGAGTCTGTCGCTCTTCCTGCACTGTATGCCCGTGGTCGGTTCTTCAGTGCAGGTCAAGCGCCACGAGTTCTTGCTGCGGCACTCGCTGGTGTA
CCGCATCGCGATGTATTGCATGTAGCCGCCCACGCGGCTCTATTTTATTTGTCATACTGCATGGCACTAATGAACTCCATTAGACAAGGACGTGAAGAAT
ATAGATCATACACGTATGTGCACTTTCAAGTGGTTCATGAGACTGGAGGTGTTTGCTTCGCTGCCGTGCAGGTTTACATCGGGTGATGGCTTCAATGTCG
ATTGCAGCGAGGAACCAAGCTACCCGGGAGCTGGAGGCAGACACGCGTAACTTCCACGAGAGCCTCGTATGGATAGTGAGGACTTTCACATCGCGATGTA
TGTCATGTAGACGACATGCAGACCCACATTATTCAGCCAAGAGTGCAATGCACAAGACTTGTTGCAACGGGATCCACGAAGCTACTTGCAATGGTAGAAT
TCGAGTACAGAATGAGCTTAAGCTGTACCGCGTCGACGTAATTTGCTGCCCTTTGTGACGCCACTAAGCGGCAAAGGCAGCATGTCCATGGCAATAGAAA
CGCTCAGGACCTCCAAGCAGCGTCGCGCTGCTTTGCGTAACTTCAAACGATCTCGAATCATGCACAGCATGGTGGCCTCTCTTTATTGTTGCTTAGCTTT
ACACCTCGAGGTGGCAATACTCACGAACGCACTGGA