Description :
From Genome Similarity Track
Location :
Scaffold_762:7- 1642
Sequence
1635 bases(100 bases per row)
TACTTCCGTTCGAGCCACGCCCGTACGAAGGCCCTCTATGAAGATGGTAACCAAAACCAATTTCTGGTAAGGCATCAAGCTGCATGGTAGCGATTAGAGT
TCTCAGTTCCTGGACGTAGTCCGATAGTTCTTTCTTGCCCTTACGGGCAGATAGAACCGAGAACGCACCCGGTATGCCTGATTAGGCGGAGAAAACACCC
GGGATATTTGCTGTTTTAGTAAATCCCATGTGGGGAAAGCTTCGTCTACCGACGTGTTACACGTGAGAGCCCATTCTCTGGCTCTACCACCCAGTTTTGA
GATAGCCATCCCAACTCGCTGTTGCTCCGACCGGAACATAGCAGAGTTCATAGCCATTTCCACCTCTCTGATCCACAGGAGGAGATTCTCCCCTTCTTTT
CCTTTAGATGTCTTTACAGTCAAGACAAGAGTGCGAGCCCTTGGCTCTTCATCAGGTATGGGAACATACCGAGTAGGCATAACCGATGCCAAATGGTCGT
GTACTTGTCCAATCAAAGTAGACTCAAAACTATAAAAAAGGGTCAAGACGTGCACGAATCACGTCAAGACCTTGTGATAGGATTATATCCACTTGTTCGT
TCCCGACTAGCGCTCTGAGTTTCTCCAGCGCTTATCCTTAAGCCTCAGAGAGGTTTATCTTTGTTTCCACCTTACAGATGAACAGTCTTTAACAGACTCT
GGTGTAGATTGACTACGAGTGCTACCAAGTGTCGCGGAGCTACCCTTACTCCTTTGTCAGAGGAAGACTTCTAGACTCGTAGAGACCTTAGTATACTAAA
CTAAACGGATATTAACTTAAAGGGTCTCAAGTCTTGCAGACTTAGTGAGACTTGACTCTAAGTGTATGTACAAGCTCTTAAGCTTCTATTCCTGGTTCAG
GGGACTACAACTTCAAGGAATCACGTGGCACCAATGCCCAAGAGTACTTAGCCTTAACTCAGGCACTTAACTCTTACGACCAGAGACGTCTTAGAAAGAC
ACGTGTCTAAAACTGATCAAAAGAGGAACTGAATATATTTACTGATTTCTAGCGATAATAAACCTTACTTACGTCTTTAAGCTTAAAACTATGCTACCTA
ATCGAATAGTCCTCATCATAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCCTATTACGATAGATATCCTCTAACCATAACCGA
TAGGGTACGGAATTATCGCTTAGCATATGCGATACAAAAGTATGCCTTATCAGTGATACTGATCTCTTTCTGTGTGTACCACACCAATGTACCTGGTTAT
CATAACCATTTGTGTAACCCCGTTACATCCTCCCCCACCAAAGAGTCGATACCCCCCGAATCGACATTCTTCACCTTTCTCATTGAGATAGCTCGGAGAG
AACAGATATCCTCACGGTTGTGTTCACGACACCTTGCGCATCAATGGCGAAGTCTTCGCTCTCCTCCGAGTCTTCGGAAGACATCATACGCGAAGAGAAC
ATCGTTGATCAGGACAATGACACTGTACTGGAAGAGAGTGGAACCCCCGAACCTGCCACGTCAGCGTCGTGCGAATCTTCTCGCATAGCGCCAAACCCAT
TTCCGGAACGAAGCACGACTCAAGGGCTAACAGCG