Description :
From Genome Similarity Track
Location :
Scaffold_1271:7- 1626
Sequence
1619 bases(100 bases per row)
CACGACCAGTGGTCCCACGAGTGCTAGAGCGGGTGGAAAATGTGGGCCATGGGTTTGCGAACCATGGCTTAGGCTCTTGCGCCCTTGGACTAATTTTCGA
AAATGTTCGTCCCTCACAGGGCTGATAGATGGTGAGAATATTTGACTGTGATTTGTGTGACGTGGATGTTCTCAGAGAGACTCGAATGAACTCACGAACG
CCAGTCAAAAGATCGTGTGATTTTTGACTGGCGAAGAGACCTGTGGTTTTTCAAGTTTGAGCTATACAGTTCAAACCCTCAGTGCTGCTGATGAAGCCAC
GCAACGATGTCCATGTGTCCACTAAAGCTGGTCATGTCCATCGCAGATGCAGTTCTTCTCATGTGTGCCTTAGAAGCTGTTCGGGATGACCGCGTGGCGC
CGCAATTGTCGCCAGCGATCTCGTACTGAGCTTCACTATTTTCTGAGCTTCAAGAATCGTGTCTAGCCACTGCACCTTCTCCACGACGACGTCATGGAGC
CATTTGAACAAGCTCCGGCGCATTTTGACGAGCATCGGCTGCTGGATATCATCCTCGCACGAGCACTGCATTTCTGAGGGAAAAAAACTCGGGATGGGGA
ATGCGAGGATGCCGAGCTTGATAGCCTGACCCGCTTCCTCCCACCGAATGATTTTGACATGCGTCCGCTGGAGGTGAGTGACCATGGCGGTATTTTTCTC
TTGAAGTTCAACGTCAAGAGCTATCAAAGACATCCAGAACGGCAGCCCATCTGCCAAGCACAAGGCCATCGATTCCATCCAGTGTCTCTCATCAGCTTCT
CTTTCCAGCGTCTAATCAAGACCTCTCAGCTAGGGCGAAAGAGCTCGCCTGCATACTTGCATTTCCAAAAAGACGGCCCACAACTCACACCTGATCCACG
AAGCTGCTATCAACGCCATGGGTGAGCCAGTGCACGACGGCGCTACCGATCTCGCACCACTCGTTGGCCCAATCTTCGTTTGGCGTCGTTGCGTGGATCT
CCAGGGTTCGCCTCACGTACTGCACCTCGTCAGTGCCTTCATTGACAACTCCAATACGTTCGCCTCGCTCTCGCAAGCAGCGAAACGTGGGTCACTTCAT
CTGCTCAAGCGCGTCGCGCACTACGACGACCGACGCTGGCAGCACGAGGGCAAGTCTTCATGGCGCATCAAGAGCTACAAGCAGCAACAGTTCACCAGGA
CGATGGAGGTGGCGATCGAACGTGATGACGTTGGGCTCGCCGAGTGGCTATGTGATACGTACTTTCCCGAACGACGGGTGGAACCGCGACGACTGCTGGA
GCAGGCGCTGTTAGGGAGCGATTACGAGATGCTCGACATTGTCGAGTGGCTCGTGCGAAAGTTTTTTCCGACACCGTCCCTCGATCATCGGTTGCTAGTC
TCTGCTGTGTGCAACGACCAGCTCCATCTTGTCGAGTGGTGATGGGCGAACCAGTCCCGCGGTGCGTTCTTTGCTGACATGATGGCGCACGCGCTGCGAG
GTGGCCATGTTGATGCTGCAAAGTTCCTGCTGCCGATGCTCCCACGTCAACTTGTCCTGCCAGAGTCGCACAAGTTTGTGAGTTCGGCAGCACATAGTGG
AAATGTTGAGCTCCTGGAG