Description :
From Genome Similarity Track
Location :
Scaffold_1571:7- 1530
Transcript NameFunction/comments
Phyta_totarag13275hypothetical protein

Sequence
1523 bases(100 bases per row)
CACGCAAACGTCGGCGTAGTTGCCTCAGCGTTTCTGGtatcgtcgtccagcgcggGCGCACTTGTTTCGTCCGCATTCGAGTGGCCCGTGAATCGATGTT
CTGCTTTCTGTAGCGATTCGTCTCCTCCGTAATTCTCACCCACAACGCCTTCGGCAAGATATAGAAGAATAGAGCTAGCGGTGAGTCTGCGACGTCTCGT
AGCTCGGGAATTGGTGTTGCAATATCATCCGAGAGCTGATAGTAGCAGGCCGGGTCAGATTTGAACGTAGACGACGGTGCGCCCCACGCAGTGCTTCCTT
GTCAATGTTGTCGATGGACAGTGAACCCCCCAGTGAGTCAATGAAGGCCTCATCCACCAAAGCCATTTAATTTTCGGGCGGACCATCATCCTGAGGATAC
TCCCGACGttcgacctcctcgtcgtcgtcgtcctcctcctcgtcactcCCGCTAGACCCAATGGTATCAAATTCGTCTGAACCCTCCTCGTCTTTCAAAA
CGTTCACATCATTCAAGGGCACCTGAATCGCCCTCGACACCATTGGTTCCTCCACATCGTTTTCATCACACAtggcttcgtcttccagctcgttAACGCG
TAATCTGCTTCAGACACCATCCGCTACCAGGTACCCACAACGACCTCTTGGTCGAACGCATCCATAGGTTCCAAAGCACGCTGTGACAGGTCGAACGCCC
TCGCCACAGCGTTCTGAGACAGAGCGGTAACTTTCTCTTGTCCCGTCTCATCATCAATATCACCACTACTACTCTCAAACAGTGAATCCAACGTGAGCAC
TAATAGCGCCAACGAGCAGTCAATTTGAGACGCCGACACAGCCTCGTGAGATTGTGGCGCCAAAATGCcctcgtccgcgtcgtcgtcttgctcttcgccA
CTCTCGTCCAGGTTGATCAATCCGGACACGATCGCAAACGTGACAACAGCGTCCTCTCCTTCAAAATACACTTACAGTCACAATAGGTTGGGTTTAGGCA
AATATCAAGAGTCCACTTACCAGTGAACATGTTGACCCCTTCCACGAGCACATCAACTTTTCAGTTTGGCATAAAGTAAGTCCAATCGTTCGCGAgcttc
gacggcttcttcgactgtCAGCCAGCTGCtcggagctgccgccaaATATGTCTAAAATCGACTTCACGGGCCGCGGGTGCTTGCTTAGTACGTTCACTCC
TGCAAATCCTCGCCATAGTTGTCGCTTGACCCTCCCGCTCAAATCTTCAAATAAGAGAGTTTTCCCGCCCGTTCACCCACCACTCAACTTTGATGACGGC
TTCACACTTTCCCGTCTACCCTAGCCGTTGTACGTTTTGTGCAAGGCCGAACTTAACCCCTCCCAGCTTATATTTATTGCCGGCAAAAATAGTCTTGATT
AAAGTATGCAAACTTTTTTCGAGCCATTTTTTATTTGAATCGATCAATTAAGTCGTAACTTACGACTTAAAGACTCGGTTTCGTCGTAACTTACGACGTT
GGTACTGGAGGGGTTAGTAGTTT