Description :
From Genome Similarity Track
Location :
Scaffold_416:7- 1424
Transcript NameFunction/comments
Hyaar_Emoy2814094ATPase AAA

Sequence
1417 bases(100 bases per row)
ACGCAACGGGTTGCTGTACTATACAGCCGTTGCCGGCGACACGCCTCGTGTTGTCGTCCCCGCTCATAACGATCTGCGCTTGCACATCATGTATGAGTGT
CACGATGCTCCAACAAGTCACCGTCGCGGTAGAGAAAAGACTTACCTTAAGATAAGTCGTGACTTTACTGGCCCCGACAGTATCAGTTTGTACGCAAGTA
CATTCGTGGTTGCGAGGTTTGTCAACGGGTGAAGCCTAGTCTTTCATCCCGTGCACCCTTACAGCCTCTACCTGTCCCGGAAGAGTGCTGGTAGTCCGTT
TACCTGGACTTCGTCTTCGGTTTCCCCGAAGACACTCACAAGAATAACGGTATTCTTGTGTTCGTGGACCGGTTCAGCAAGATGGTGCATCTTGCTGCTG
TACCCGAGTCGATCACGGCACAGGGCTGTGCTCGTGTCTTCATCGACACAATCTTTCGACTCCACGGGTTACCCCGTGAACTCGTATCCGACCGTGACCC
TCAGTTCACGGCGGAGTTTTGGCAATCCGTGTTCCGATCACTCGGAACGCGATTGAAGATGTCAACATCTGACCATCCCGAGACAGATGGTCAAACGGAA
CGTGCAAACCGTGTCTCGAAGAGATACTTCGAGGATAAGTCCACTCATTCTCGAGTTGGAGAAAATTTCTCCCCATGGTGGAATTCGCCATCAATAATTC
GGTGCATGCGTCAACCCAGTACACACCGTTCTTCGTGAATGGCTTAAGCCATCCGCGTCTGCCCACCCTATTAGAGTGTGACTCTTGGTTAAGGGGGGGA
GGGACTCTCTCCAGCACAAACCGTTCTGGCTCTTGCTCATCACATGTCGACGCTAACGTCGTCACGTATGATGTCGATCAGGTCGACATCGAAGAAGAAG
ATCATCTCAATAATGGCGATAACGCTATTATTGAGTCAGATGATGATGACGATGCTGGTATTTTCAGCATCGCCAACGACTATTCCAGCGAGGATGATGA
CACCCTCGCTGACGAACAGAAAGAGGAACGAACTCTTTCTGCAGTTCGCACAAGGCGAACTGAACAAAACAATGCCTCGTCAGCAGAAGGATTTCTGCTG
GCTCGAGAAGCAGTGGTCCGTTTCGTGCAGGACTCTATCGCTCACGCGGTGGACCGGCAGAAACGGAACGCTGACAAGAATGGAAGAGCAATTGTTTTTT
CATTTATTGAAGCCGATTTAGTCCTACTATCTACGGTAAATCTACCTAGACAAGTAGTGACTAACGTGGGCAGTAGTTTACTACTGCCCAAATACATCGG
TCCCTTTCGTGTGCTGCGCCGACAACGCAACGCATACACGATCGAGCTGCCGCGTAGGATGCGTACGCATCCTATGTTTTACGTGGGGCGTCTCCGCCCG
TACTGTCAGTACGAGCC