Description :
From Genome Similarity Track
Location :
Scaffold_5540:7- 1314
Sequence
1307 bases(100 bases per row)
ACATGCACAAGTACAGCGAGGACACGCAGAATCAATACGTTCTCTAGGCCGGCTGTTGAAAAAAGACACGACCTGAGCTAAACGAACATCAGCTCACCTT
CGACTCCGCCAATCAGAGACTGCCCAAGTCCCGATTCTCGTCTTCCAAGAAACGGTCTGCCACACTGCGGCGTCCGCGACACAAGCGACATGTGCGTTTG
GCTGCGTTCTGATGCAGCACCAAAATAGACGAGCGTGCGTCATCTCAAACTAGAGACGCCAGCTACGACCATCTAAAACTAAATATATGGTCCATTGCAA
GGAGTTCCTTGCCACCGAGTACGCGCATGTGAAGCTTCACGTTCACCACCTTGGCAACAAGACTTTTGCGATCTATCCAGATCATGTCGCTGTGCACGGC
GATGAACTCGCTTCCTTTGCCGCAACGGATGGCGCGTTTGCTTCCCTTCCTCGCGGAGTACAACTTCGTTGACAAAGACAAGCCCTGTCAGCTGAACGTA
CTCGTCGGCGCGCTGTCGCACCATCCTGACTTCGAGCAAGTTTACTTGCTTGTCCTCCAAGAAGTTGAGCTGACATCGCTTCCATGATGTTTCGGGTCGA
GTCGTCACTGAGCAACAATTCCCGTGTTGCGTACGCGCGCGGCGATGAATACAAGTCGCTCTTGGCGTACTTAAGTTCGCCAAAATGAAGAGCCCTCAGC
TGTCGACTCATCCAACATTCATCGTTATCGGTCAATGATGATGTGTTGGGATACTTGGTCTCTCTAGGGGAGCCTCAGGTCTTGAAAATACAAAATCTCT
TTGGGCACTATGACTCGCATCTGGGCAGTCACTTTAGTCGCGAGAAGACCTTTGTTGATGTGGCGCACTTCTTCTGGTGGCTACACCAGTACCATTGGGT
ACGTAACTTCGTGTGCCACGTGCAACCGCTGAGTCTCGCTAGCGTCGCTGTGCAGCCTATCAATTATGTCTATTTGCTGACAATTGGTCTTTCTCAAGTA
TGTCTTCCGCCTGGCGAAGGACAAGCACCAATGCACAGAAATTGTTGTGTTCGTCGACCGCTTTAGCGCTTTAGCAAAATGGTTTATCTAGCCCCAGTAC
ACGCAAGCGCCACTGGCAAACGGTCGAAATGTTCCTCGACCACTTGCTCAAGCACAACAGTATGTCCGACGACCTCGACTCCAATCAAGATCCTCCTTTC
ACTGAATCCACAGGGTTCAGCGGCTTCCACCTCTTGTGTACGAATCTCGACGGCATACAACCCTGCGACAGATGACCATATAGAGCAACCATGTAACGGG
GTACACG