Description :
From Genome Similarity Track
Location :
Scaffold_5003:7- 1295
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5003-fgenesh-gene-0.0Dual specificity mitogen-activated protein kinase kinase

Sequence
1288 bases(100 bases per row)
CAAGGTACAATTTCCAACTGGAAAAAACTCACCTTGATCGCGACCACTTTCAACGTTGGGATGTGAATCGCCTTGTACACGATTCCAGATGCTCCGCGTC
CCACTTCTCGCACTTTCTCGAGATTCTCCTGCAAATGCAAGCAATCAGCATCCAGCGACGAAATACCCGCCTCCGACACTGCGACGCTCTTGGTCGTAAA
CATCCCGTGGTTTGGAGAGTACGCACTGCCAGCACTGCGGCGTCCAGCATCTGAATTTTGCACACACACCAAGTCAGTAATCACAAACAAGCGCACGCAC
ATGGGAGAGAGCGGCAGTTCTTACCACTTGGAGACTGCACGTCCGAGTCGTCGGAGCTGTAGGACTTAAAGTTCATTCGTAGTATCGCATTCTGCGTCGC
ACTCGCGTTGCCGTCAGGGTTCGGAAGCCCAGAGGCTGCAGATTCCTCCATCGCCTTCTCCATCGCCTCTCGCTTCGCGATCAATCGATTTGCAGCTCGT
TGCGCTCGATCTTCGGCTTGCTGGGGCGTCGGCATGTCTTCTAGCTTCAGACGGAGCTGTGGACGCTTCGACGACGACGAACTGAGAGAAGGCAGCATCT
TCCGCTGAGGCGACACGACATGGTTTACTTGATTCGATGTCACTGGCACCGAGAGTTTGTCTTCCAAGGCGAATTCGTTCGCTAGTTGCGTGATCACATT
GTCCAGCTCGTCAGGCTCATCGGCAGCACCGAGATTCAGCTTTACCCCAGTTCTTGGACTCCACAGCGGCGGAGTGAACACCTGGAATAGGCTTGCAAGC
TCAGGTTGCTGCCTGGTTTGTCGAAGCGGAGGTGGCGTCTGTGGCTCCGCTGGTGCACTGGGCAGTACGTGGTCTGGTTGCTCCATCCAATCGCAGTACC
ACGACTTGACTTCTGCGATTCGCAGGTTGCGCGGATTGATATCCGGAAAAATGTTTGTGATCGCAGTGTTATCCGCCTAGCCATTCGTTCCACAAGCAAC
AGCAAAAAAAACCAGCATCCCAGTACTCGGTCAGTGACGACACCAATGCGTTAAGCAATACACAGGCAGAAGCGTACCTGTCCAAACAAATTGGGCGTGG
AGTGCGACCGCGGCAGTCCGCGTTTGCTCCTCCCGCCAAGGCCAGACGCGGCGGCGGGCACACGACTGCCCGTGCCGATGCCCGACTGCAGCATCGTGAT
GGCGTTGCTGCGGCTCGCGGCGCGACTCGACGGCTGCTCGTCGTAATTCGCGCTCTCGACGCGCCCGCGCTTCTTGAACTTCTCTGCG