Description :
From Genome Similarity Track
Location :
Scaffold_5789:7- 1241
Sequence
1234 bases(100 bases per row)
GACCGCGGGTCGTTGATTCTTTTGGTTTCGTCGCGTCTGCGCTTCTCGTTGACTCGCCATGGTTTTGTGCATGAGCTGCGCACTTCTTCTCATGGCTCCG
AGGTTCTCCTCAATCTCCTCGGGTAGTTGGCCAATGTGAACCAACTTCTTCTGTCTCTTGTCGAGCACAAAGTCGAGCGGCGACACTGCCGGCAGGACAC
AAAAGACTTCCACAGGAGCGACGTTCCCAAGCGAGGGTACTGGCGTGTGATTGAGACTCGCCTGGAGGACCGGAACAAAGTAGGTCCAGTCCTTGATATC
GACTTTGAACTCGAGACACATTGCCCGTAACACCTGCTTGATGTCCCTGTTCACTCGTTCAATAGACCCATTGAGCCACGGCGAGTAGGCCACCGTCAAG
TCTTGATCGGCGCCGAGCCGCGCGCTAATCTCCTTGAGCACTTCATTCTTGAAGTGGGACGCACTGTCGCTGACCCACACTCGTGGAGCGCCGTATCGAC
TGTGCCAGTCCAATATGGCCTCCGCTGCTACAGTACTGGTCGGCGTCACACACGGGACCAGCTCGCAGAAATGAGATGCGTCGTCCTTGAGCACGAGCAG
GTAGGCGTAGTTTCCGTAGGTCTTACCGAGATGCACAAAGTCCCAGTGGAGAGCTTCGTTGCGTTCCGAGCTCCGGTAGGTCTCCCCCCATGGTCTTCGT
ACCATCCTCCCCCCTTTTACATGCTTGCACATCAGGCACGTCGCTAGGAAATTGTCCACACGCTGGCGAAGATTCGAGATCACAAAGCGCCGTTGGAGGG
TCGTCATCAGCGAGTCGCGACCTCTGTGTCCTTGCGGTCCGCAATGCGCGATCACAAGTAGCCGATAGATAAGGTCGTGAGCTGCTGTCGGTATCCATAT
CCGATCTCCATCGCATAAGAGTCCGTGCTCGTCGCGGCGGAGTGATCTTGGGTGGTCCACACCTTCTCGTTCTTGTGCCTGGCACAGTTCCGATATTGTT
GGCCACACAAAGTTTCCATCTTGGAACGGTCGTAGTGTGTGCGTCCGGTTTGCGTCGGTGGTTGAGCTATTCTGGGCGTCTGCCCACCGAACACGCTTGC
GTCGCACTCGCTTGATCGCTACATCGATCACTCGTGGGCTCCCTGCCCAACGAGACACCATATCGGCCCAGACATTCCGGATGCCGTCGATGTGCTCGAT
GGAGTACCTGTACTCCATCAACTTCATTGCCCAC