Description :
From Genome Similarity Track
Location :
Scaffold_1141:7- 1224
Sequence
1217 bases(100 bases per row)
GGTCCAGACGCAGCCCAACGTAGGCCGCCACAAGTTCTCCAAAAAGACCCCTAGGCCCAACCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATTTCAG
AAATGGAAGAAGAAGCTTCGGAAGGTATTTGGTGCAGTCGGTATCAACGCTGCAAAGCTGCCTTTGAGTCGACCGACCGTTCTTGATGAAGATCCTTCCA
AGATTCCGCTTCCGCAAACACCCGTGAGACTCGACCATACTCCTCCGACCAAGCGTGGAGCTGACCGCGGTGCCTTTTGGCACTACCGAGGCTTCACCGT
ACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGATAGCCGTATGCAACGTGTTTACGCTGGTAACGAGGGTTCGGTCGGTCGCCGAGGCGGTGCGCG
AGCTCCCAAATGTGGTGCCGGACGTCGTTAAATCGACAGCGACGGTTCATCAAGTGACGATGACATTTTGGCGCGTACATTCGACGAGGAAGACCCTCAA
CTCGTGTTGATGCGTCGGATGAATGAGCTGGCGACGCTGAACGACGTGGACCCCGACCACCGAAGGATTGAAATGGCATCGCACCGACCGTTGGATCGAA
TCAGGCCGTTCTCAGGCTCTCGCAACAAGAGCGAGAACTGTATGCAGTGGCTCCGTGGGTTCGTCTACGAAGTGACTGAAACCCACACAGATGCCGACAA
ATGGTGCATTCCATTTGAGCTTAGTCTCCAGGACGGAGCCATCCATTGGTTCCGTCAACTTCTGAAGAAGACGAAGCGCAAGTGGAAGCTGCTGAGCGAT
GCGTTCATCCGATACTACTGCTCGTAGTTCACGCAGACGGCACTGTCCCATTACTACTCTGCAAAGCGGGAACGTAACGAACATCTGTGCGACTACATAA
ACAAGCTGAATGGCTACGCTCGAACCGCCCGTCTACACTTCGAGTCGGTGGTCGCGAAAGAACACGTACAGAAGTTCCTTGCGACATGCGATGATGACAA
GTTGGCCGAGAGTCTTTACCACGCTCGAGTCGCCGACATTCACGAGCTCGAAGAGATCATCGAAGATGTTCTCAAGGGCAAGGAGAGAATGGCTAAGCGT
GACAGTGCTGGGCAACTATATAATTCTAGCGCCTGAGCTGCTTAAATATGAATCTGAGAAATTGAGTGTGCATTTGATTATCGTTGTACAATCTGCCATA
GGATCTGGTTTGCTGCT