Description :
From Genome Similarity Track
Location :
Scaffold_1498:7- 1212
Sequence
1205 bases(100 bases per row)
AGGGACAGCGATAACGAGGATATGGCAGTGGCAGTCAACGCTGCTACCTGATTCGATAATCCTGCCAACTGGTTCAATTGGATCGTTGCACACACAACCT
CACACAGGCTATCAGCCCGATATGATTCCTGCCACGTTTCAGCTAGCTGGACGCTCCCTTGAGTGACACATTGTTGAACAATAGGAGGGACGCTGGCAGT
CGGCAGCTTCCGAAGCCCAATCCAGAACGAGTCGGATACGAAAGCACATTCCACAGGTTTTTGCCGTCCTTCTGTGTGTAATCCCCGAAACTCACAGTTC
CACCTGATTTCAAAGTATGCGCTGGTGGCCTCCTTCTAAAGTCGCATCGCCTTCAGCTTTTGAATTGTCAGCCCAAATTCCGGAGAATAGTCGATCGGAT
CGTTTGGAAATCCTAGCAGTTTAGACCAAGTGACAGGGGGATCAGGTGCATCACTGCCGTTAGGTGAAAGAGTCCCAACCAGGCAAAGCGTCCATTTCGG
GTAGTAAGTGGAGAGATCACCTGACGGAATTGCGCCCTCAATGTTTACAGGCAAGAGCTCAGTAAACGCTCTATTGTTCACGATCGAGAGGACAGTAAAT
AATTCCATCGCTTCTTGAAGGCGCCGTACCCGGGCTTTATCCTGCCGACTCTCGTGATCTACTGGGAACCGGAGAGCACACGTTCGAGCATATTGCAATC
GTTTGGGACGGCATGGACAGATAAACGAGACGGTCATAGTACGACGCGCCGTCATCAAGTAGTGTTCGCTCAAAACTGTACGCCAAGGTTCCAGGAACTC
CCATTCCGTCATCTTGCTGGGTTCGGTCACACTTTGAAAATGTCGATAGTGTGATGCAAGAATCGAATCGGCAGTCGATGTCACCCTACGTCAGCTCCAG
GTAAATTACTACCGACAGGTAGGGCCAGACAGCTGTGTTGTCTCTCCTTGAGTGAGCGCATAGTACCTATCAGTCGCAATATCACATTCAACCTTGATCT
TTACCCTGAATCTCCACACTGGTCAATCAATAGACAGATTTCAATCCGTTCCGAGTAAACGAAAGAGCAAGTTCTGGCGAATTTGACGTTGCTGCAATTT
GCTTCATGAAAGTAAAAGGCAGTAATTACAGGCTGAAGGCAAATTCAAAGTCAAATTTGGCAAATGTTGTCTCGAAGCATTTTCACTGTCTTACGACTTG
CTTTC