Description :
From Genome Similarity Track
Location :
Scaffold_5316:7- 1037
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5316-fgenesh-gene-0.0Carbohydrate-binding protein

Sequence
1030 bases(100 bases per row)
CAGTGGACGCGCACGAGTCAGAAGGAGAGAGTGAGCACAGGAGCGACATCAGGCGAATGATCGAGTGCGTAAGAGAGAGAACTTTGTTCAGCCAAGCAAA
CAAAAAATACAAAAAAAACAAAGAGCTAATAAACATGAGAAAATGCGTCCATGCATTTTTGCCACAAACCTATGGCTCTGGTGGTCGCTCCTGCTCGTCC
ACGGCCGTCCAGTAGATTCTGTGTGGAGCAATGGGGGGGTGGACTAAGAGTTGCAAAACAGTCGGTTGGTGGTCAGCGAAGGAGATAGAAGTTCATTGAT
TCGTTGCCTACGGGTCTTCAGGCGTTCCAGGTTGGGTGCCACAACTGCGGACTGCTACGCTCTGCTTGCTGATTGTGATCTTCAGCAAAATCTATCGCCG
CCAGGTCTCCTTGATGAGCTTGATGTCCGCGAGGTCGTCGTTCAGGATGCTGGTGAGGTGCTCAAGACCCTGGCGTTGCTTGTCCAAGAACTGATAAAAA
TGTCGCCAGATACACAAGACAAAATGTTAGACTTCATGAAATTGGCGGATGAGTGACAGCCAAAGTCGTAATGTAACCTGGTAGACGCGCTGCAAGTCCT
CTGGGCTGAGCTGGTTAGCGGGCGGCGCAGGCGTAGCCGCATCCTGGATGCGCTGAAGCGCCACCGCGTCGTTCAGACGCGCCTTGTACTGCGCAGGAGA
GTCCAGCAGCGTCTGGAGCTTCTTCAGCATCATTCTGCAAACAAAACATAGAAAAGCACACACAAATGGTGAGCTCCATTGTCATCTTATCCTCAGTCGA
CGAACCAAAAAAGACGAGTGCACGTACGTCAGTTGCATCTCGTTCCTCTGCAGTGGCTTGCCGTAGCTTTGTAATAACTCAATGTCCTTCATCACCTGGC
AACAATTAAATCACACACAAAATCAATAATTTTATGAAAAACAACCATAAGCACCCAATATTCAGCAGTGCGTACCTTGACGAGCGTGTGGAAGAGCTGC
ACGTGCTCGTGTCGGCACTTCTCGAGCTTC